Autosomal Recessive Nonsyndromic Hearing Loss 48

Mendelian MONDO:0012273 Pathograph 33 Show in embeddings browser Autosomal Recessive Nonsyndromic Hearing Loss

DFNB48 is autosomal recessive nonsyndromic sensorineural hearing loss caused by biallelic CIB2 variants. Hearing loss is bilateral and prelingual, including documented congenital cases, and is usually severe to profound; moderate-to-severe hearing loss has also been reported. CIB2 is an auxiliary component of the cochlear hair-cell mechanoelectrical transduction (MET) complex. Experimental loss of CIB2 impairs TMC1/TMC2 localization and channel function, with additional abnormalities of stereocilia maintenance and later hair-cell degeneration. Missense alleles differ in their effects on residual channel function. CIB3 can compensate in vestibular hair cells in mouse models, whereas its low cochlear expression does not prevent deafness. Later clinical series challenge the original assignment of CIB2 to Usher syndrome; vestibular compensation does not itself establish the absence of retinal disease.

Ask OpenScientist

Ask a research question about Autosomal Recessive Nonsyndromic Hearing Loss 48. OpenScientist will conduct autonomous deep research using the Disorder Mechanisms Knowledge Base and PubMed literature (typically 10-30 minutes).

Submitting...

Do not include personal health information in your question. Questions and results are cached in your browser's local storage.

1
Inheritance
9
Pathophys.
5
Phenotypes
1
Gaps
33
Pathograph
1
Genes
12
Variants
6
Medical Actions
3
Models
17
References
1
Deep Research
👪

Inheritance

1
Autosomal recessive HP:0000007
Biallelic CIB2 variants; heterozygous carriers are unaffected. The locus was mapped in consanguineous Pakistani families and most reported affected individuals are homozygous, though compound heterozygotes and a pathogenic variant in trans with a frameshift are also described.
Autosomal recessive inheritance
Show evidence (2 references)
PMID:29112224 SUPPORT Human Clinical
"Of the 6 families we ascertained, 3 segregated novel loss-of-function (LOF) variants, 2 families segregated missense variants (1 novel) and 1 family segregated a previously reported pathogenic variant in trans with a frameshift variant."
Documents biallelic segregation across six families and the range of allele combinations seen, including compound heterozygosity.
PMID:23023331 SUPPORT Human Clinical
"The four recessive mutations of CIB2 co-segregate with deafness or deaf-blindness while carriers have normal hearing."
Segregation and carrier hearing support recessive inheritance; the historical syndromic assignment is considered separately.
?

Discussions and Knowledge Gaps

1
Does CIB2 cause Usher syndrome type 1J, or only non-syndromic deafness DFNB48?
CONTROVERSY cib2_ush1j_reassignment
Attached to
disease#Autosomal Recessive Nonsyndromic Hearing Loss 48 pathophysiology#CIB3 Paralogue Redundancy in Vestibular Hair Cells
The founding report assigned p.Glu64Asp in one Pakistani family to USH1J. Later CIB2 cohorts, including truncating and exon-deletion genotypes, had nonsyndromic hearing loss; normal funduscopy in adults strengthens that counterevidence, while young children cannot exclude every later-onset manifestation. Minor vestibular findings in the Dutch series included slight hyperreflexia in one adult and unilateral weakness measured after cochlear implantation in one child; these do not establish the congenital vestibular areflexia of Usher type 1. Mouse CIB3 redundancy explains preserved vestibular function but does not establish retinal redundancy. A later retinal study reported RPE defects and reduced retinal responses in Cib2-deficient mice, so absence of mouse retinal involvement is not uniform across studies. Those experimental findings do not establish retinitis pigmentosa as a human DFNB48 phenotype.
Show evidence (8 references)
PMID:23023331 SUPPORT Human Clinical
"we report that mutations in CIB2, which encodes a calcium- and integrin-binding protein, are associated with nonsyndromic deafness (DFNB48) and Usher syndrome type 1J (USH1J)"
The original dual assignment as the founding paper stated it, which is the claim the later cohort disputes.
PMID:29112224 REFUTE Human Clinical
"This report is the first to show that biallelic LOF variants in CIB2 cause ARNSHL and not USH."
Refutes the USH1J assignment for loss-of-function genotypes, which is the strongest test since null alleles are the ones classically expected to give the syndromic phenotype.
PMID:29112224 REFUTE Human Clinical
"Here, we provide evidence disqualifying CIB2 as an USH-causing gene."
The authors' explicit statement of the reassignment they are arguing for.
+ 5 more references
⚙

Pathophysiology

9
CIB2 Loss of Function
Mechanism confidence: Established
Biallelic CIB2 variants reduce or abolish the function of the auxiliary MET-channel protein. Human disease alleles include missense, nonsense, frameshift, splice-site and exon-deletion variants. Null and missense knock-in mice support loss of function, but different missense alleles retain different degrees of TMC binding and channel activity; a simple N-terminal binding versus C-terminal calcium-buffering division does not describe the later functional evidence.
CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this pathophysiological event involves this gene This pathophysiological event involves CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Animal models
Cib2 p.F91S knock-in mouse Mouse recapitulates Models a recurrent human missense allele, allowing comparison with complete loss of CIB2.
Downstream
Disrupted CIB2-TMC1/TMC2 Association at the MET Channel
Failure to Restrict Transducing Stereocilia Growth
Cochlear Hair Cell Apoptosis Apoptosis follows CIB2 loss in mice; the intervening death-signaling pathway is unresolved.
Show evidence (2 references)
PMID:28663585 SUPPORT Model Organism
"we have characterized two mutant mouse lines, one lacking calcium and integrin-binding protein 2 and one carrying a human deafness-related Cib2 mutation, and show that both are deaf"
Establishes that both a null allele and a human disease missense allele produce deafness in mouse, supporting loss of function as the disease mechanism.
PMID:29112224 SUPPORT Human Clinical
"We expand the mutational spectrum of CIB2 to include copy number variations (CNVs), splice-site variants and indels"
Human families extend the allelic spectrum beyond missense substitutions.
Disrupted CIB2-TMC1/TMC2 Association at the MET Channel
Mechanism confidence: Established
CIB2 interacts with both the N-terminal cytoplasmic domain and the first intracellular loop of TMC1. Purified-protein NMR supports simultaneous binding to the two regions; crystallography and biochemical assays resolve distinct interfaces. Deafness-associated substitutions have allele- and assay-dependent effects on these interactions. Calcium-dependent fragment-binding results support a calcium-sensing role, but do not by themselves establish channel adaptation kinetics in hair cells. In 2025 fragment-binding assays, F91S strongly impaired binding to the N-terminal site, while I123T predominantly impaired binding to the intracellular-loop site under calcium-containing conditions. These specific effects do not imply that other interfaces or full-length protein interactions are normal.
hair cell stereocilium GO:0032420 Gene Ontology (GO) Relation: this pathophysiological event involves this cellular component This pathophysiological event involves hair cell stereocilium, annotated with stereocilium (GO:0032420). GO:0032420 is a cellular component from the Gene Ontology.
Downstream
Reduced Stereociliary TMC1/TMC2 Localization
Altered MET Channel Resting Open Probability
Show evidence (6 references)
PMID:28663585 SUPPORT In Vitro
"we report that calcium and integrin-binding protein 2 binds to the components of the hair cell mechanotransduction complex, TMC1 and TMC2, and these interactions are disrupted by deafness-causing Cib2 mutations."
Protein interaction experiments used transfected cells, distinct from the mouse auditory phenotype.
PMID:39773557 SUPPORT In Vitro
"Here, we show using NMR that both TMC1-NT and TMC1-IL1 bind to CIB2 and CIB3 non-competitively."
NMR with purified human protein fragments supports two simultaneous interactions.
PMID:40000792 SUPPORT In Vitro
"these variants have differential impacts on CIB2's interactions with TMC1's dual binding sites"
Biochemical testing of disease-associated substitutions does not support a uniform regional division of variant effects.
+ 3 more references
Reduced Stereociliary TMC1/TMC2 Localization
Mechanism confidence: Established
In Cib2-null mouse cochlear hair cells, endogenously tagged TMC1 and TMC2 are undetectable in stereocilia even though TMC1 remains in the cell body. Missense alleles can affect TMC1 more strongly than TMC2. These experiments establish a localization defect without distinguishing failed trafficking from failed retention of an incompletely assembled complex. They supersede earlier antibody-based localization results that appeared normal.
hair cell stereocilium GO:0032420 Gene Ontology (GO) Relation: this pathophysiological event involves this cellular component This pathophysiological event involves hair cell stereocilium, annotated with stereocilium (GO:0032420). GO:0032420 is a cellular component from the Gene Ontology.
Downstream
Impaired Cochlear Mechanoelectrical Transduction
Show evidence (2 references)
PMID:34089643 SUPPORT Model Organism
"Localization of TMC1 and TMC2 to stereocilia was detected in heterozygous Cib2+/− control mice but was undetectable in Cib2−/− mice"
Endogenous epitope-tag knock-in experiments between P4 and P8 localize the defect to stereociliary channel availability.
PMID:34089643 SUPPORT Model Organism
"TMC1 was still expressed in the cell body of Cib2−/− mutant mice"
Loss of stereociliary signal does not mean absence of all cellular TMC1.
Altered MET Channel Resting Open Probability
Mechanism confidence: Established
Residual MET channels in Cib2 E64D and R186W knock-in mice have increased resting open probability. In R186W mice lacking TMC1, TMC2-dependent currents show altered resting open probability and modest changes in unitary conductance and calcium selectivity. Adaptation kinetics and extent were not significantly changed in that preparation, so altered resting gating is distinct from a demonstrated defect in adaptation.
Downstream
Impaired Cochlear Mechanoelectrical Transduction
Show evidence (2 references)
PMID:34089643 SUPPORT Model Organism
"CIB2 affects channel resting Po without effects on adaptation."
The authors distinguish channel resting state from adaptation in the tested TMC2-dependent preparation.
PMID:34089643 SUPPORT Model Organism
"These changes in protein:protein interactions might also explain the moderate changes in ion selectivity and single channel conductance observed in OHCs"
Electrophysiological changes were measured; their explanation by altered interaction geometry remains a hypothesis.
Impaired Cochlear Mechanoelectrical Transduction
Mechanism confidence: Established
Cochlear MET currents are absent in Cib2-null, F91S and I123T mouse models, but severely reduced rather than absent in E64D and R186W knock-ins. The latter retain early TMC2-dependent function despite deafness. In null and F91S models, failure of MET occurs while tip links are still present and before extensive hair-cell loss. The primary transduction defect therefore does not require prior cell death.
cochlear hair cell CL:0000202 Cell Ontology (CL) Relation: this pathophysiological event involves this cell type This pathophysiological event involves cochlear hair cell, annotated with auditory hair cell (CL:0000202). CL:0000202 is a cell type from the Cell Ontology.
detection of mechanical stimulus involved in sensory perception of sound GO:0050910 Gene Ontology (GO) Relation: this pathophysiological event involves this biological process This pathophysiological event involves decreased detection of mechanical stimulus involved in sensory perception of sound (GO:0050910). GO:0050910 is a biological process from the Gene Ontology. ↓ DECREASED
organ of Corti UBERON:0002227 Uberon multi-species anatomy ontology (UBERON) Relation: this pathophysiological event occurs in this anatomical location This pathophysiological event occurs in organ of Corti, annotated with spiral organ of cochlea (UBERON:0002227). UBERON:0002227 is an anatomical location from the Uberon multi-species anatomy ontology.
Animal models
Cib2 knockout mouse Mouse recapitulates Reproduces the experimentally demonstrated cochlear MET defect, including preserved tip links; equivalent human hair-cell electrophysiology was not reported.
Cib2 CRISPR exon-4 knockout mouse Mouse recapitulates Independent allele corroborates absent conventional MET in early auditory hair cells.
Downstream
Sensorineural hearing impairment Experimental channel failure provides a mechanistic explanation for the clinical hearing deficit.
Profound sensorineural hearing impairment Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect expression.
Prelingual sensorineural hearing impairment Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect expression.
Bilateral sensorineural hearing impairment Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect expression.
Congenital sensorineural hearing impairment Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect expression.
Show evidence (3 references)
PMID:28663585 SUPPORT Model Organism
"exhibit no mechanotransduction in auditory hair cells, despite the presence of tip links that gate the mechanotransducer channels"
The dissociation that localises the defect to the channel complex rather than the tip-link force-transmission apparatus.
PMID:34089643 SUPPORT Model Organism
"MET currents were abolished in Cib2-deficient OHCs"
Independent electrophysiological confirmation in outer hair cells.
PMID:34089643 SUPPORT Model Organism
"MET currents were abolished in OHC from Cib2I123T/I123T mice (Fig. 7B), and were severely reduced, in Cib2E64D/E64D and Cib2R186W/R186W mice"
Knock-in electrophysiology distinguishes complete loss from hypomorphic channel function.
Failure to Restrict Transducing Stereocilia Growth
Mechanism confidence: Established
Shorter transducing stereocilia rows overgrow in Cib2 mutant mice, followed by broader bundle disorganization and regression. This growth phenotype differs from the retraction expected after MET-current loss, supporting an additional bundle-maintenance role. CIB2 physically interacts with WHRN, and MYO15A accumulates abnormally at first-row tips. WHRN overexpression fails to rescue Cib2-null bundles, and Cib2/Whrn double-null bundles show predominantly Whrn-like abnormalities with some superimposed Cib2 features. These findings support distinct functions but do not exclude every role for WHRN in CIB2-dependent maintenance. Local calcium regulation and GPSM2-GNAI participation remain hypotheses; bulk calcium responses in transfected cells do not settle local stereociliary calcium mechanisms.
auditory receptor cell stereocilium organization GO:0060088 Gene Ontology (GO) Relation: this pathophysiological event involves this biological process This pathophysiological event involves decreased auditory receptor cell stereocilium organization (GO:0060088). GO:0060088 is a biological process from the Gene Ontology. ↓ DECREASED
stereocilium GO:0032420 Gene Ontology (GO) Relation: this pathophysiological event involves this cellular component This pathophysiological event involves stereocilium (GO:0032420). GO:0032420 is a cellular component from the Gene Ontology.
Animal models
Cib2 knockout mouse Mouse recapitulates Reproduces the stereocilia overgrowth arm.
Downstream
Cochlear Hair Cell Apoptosis Bundle abnormalities precede hair-cell loss in mouse models; the intervening death pathway is unresolved.
Show evidence (6 references)
PMID:28663585 SUPPORT Model Organism
"mechanotransducing shorter row stereocilia overgrow in hair cell bundles of both Cib2 mutants"
Documents the stereocilia overgrowth phenotype in both mutant lines.
PMID:40083274 SUPPORT In Vitro
"We found that the EF2 domain of CIB2 binds to the HHD2 region of WHRN."
Transfected-cell interaction assays identify physical binding; binding alone does not establish a serial growth pathway.
PMID:40083274 SUPPORT Model Organism
"Overexpression of WHRN in Cib2KO/KO mice did not rescue the stereocilia morphology."
Failure of this rescue argues against simple compensation by WHRN overexpression, not against all WHRN participation.
+ 3 more references
Cochlear Hair Cell Apoptosis
Mechanism confidence: Established
Cib2-deficient mouse cochleae develop apoptotic hair-cell loss after the early transduction defect and bundle abnormalities. TUNEL-positive auditory hair cells were demonstrated at P20, supporting an apoptotic component. Outer hair-cell loss progresses before extensive inner hair-cell depletion in the models. The molecular route from CIB2 deficiency to apoptosis is unresolved; proposed ASK1 or sphingosine-kinase signaling mechanisms have not been established in Cib2-deficient auditory hair cells.
cochlear hair cell CL:0000202 Cell Ontology (CL) Relation: this pathophysiological event involves this cell type This pathophysiological event involves cochlear hair cell, annotated with auditory hair cell (CL:0000202). CL:0000202 is a cell type from the Cell Ontology.
apoptotic process GO:0006915 Gene Ontology (GO) Relation: this pathophysiological event involves this biological process This pathophysiological event involves increased apoptotic process (GO:0006915). GO:0006915 is a biological process from the Gene Ontology. ↑ INCREASED
Downstream
Sensorineural hearing impairment
Secondary Spiral Ganglion Degeneration
Show evidence (2 references)
url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/ SUPPORT Model Organism
"dozens of hair cells displayed positive TUNEL staining in the cochlea"
The recovered full text reports TUNEL-positive cochlear hair cells in P20 Cib2-null mice and absent staining in heterozygous controls.
url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/ SUPPORT Model Organism
"It remains unclear how the absence of CIB2 leads to hair‐cell apoptosis"
The direct death-signaling mechanism remains unresolved.
Secondary Spiral Ganglion Degeneration
Mechanism confidence: Established
Progressive spiral ganglion neuron degeneration follows sensory hair-cell loss in Cib2 mutant mice. This later model finding is distinct from the primary transduction defect and does not establish neuronal degeneration in human DFNB48.
Show evidence (1 reference)
PMID:28663585 SUPPORT Model Organism
"The loss of sensory hair cells was followed by the progressive degeneration of spiral ganglion neurons"
Histology establishes the temporal sequence in mice; the intervening trophic or injury pathway was not resolved.
CIB3 Paralogue Redundancy in Vestibular Hair Cells
Mechanism confidence: Established
CIB2 and CIB3 have overlapping roles in vestibular hair-cell MET in mouse models. Cib2/Cib3 double knockout disrupts vestibular MET and balance, whereas either single knockout preserves substantial vestibular function. Region-specific structural and dye-uptake abnormalities can still occur in single mutants. CIB3 can rescue MET when introduced into Cib2-null cochlear hair cells, while CIB1 cannot. Endogenous cochlear CIB3 expression is low rather than absolutely absent. Vestibular compensation is not evidence of retinal compensation or a proven human modifier effect.
vestibular hair cell CL:0000609 Cell Ontology (CL) Relation: this pathophysiological event involves this cell type This pathophysiological event involves vestibular hair cell (CL:0000609). CL:0000609 is a cell type from the Cell Ontology.
Show evidence (5 references)
PMID:34089643 SUPPORT Model Organism
"CIB2 is a Ca2+- and Mg2+-binding protein essential for mechanoelectrical transduction (MET) by cochlear hair cells, but not by vestibular hair cells that co-express CIB2 and CIB3. Here, we show that in cochlear hair cells, CIB3 can functionally substitute for CIB2."
Cochlear rescue supports functional substitution by CIB3; vestibular redundancy is tested directly in double-mutant experiments.
PMID:34089643 SUPPORT Model Organism
"Both CIB2 and CIB3, but not CIB1, rescued MET defects in OHCs from Cib2"
The rescue experiment, with CIB1 as the negative control that makes the result specific to the closest paralogue rather than to CIB overexpression generally.
PMID:39773557 SUPPORT Model Organism
"these results support compulsory but functionally redundant roles for CIB2 and CIB3 in the vestibular hair cell MET complex."
Single- and double-mutant comparisons provide direct support for vestibular redundancy.
+ 2 more references
⬡

Pathograph

Use the checkboxes to hide or show graph categories. Hover nodes for evidence and cross-linked metadata.
Pathograph: causal mechanism network for Autosomal Recessive Nonsyndromic Hearing Loss 48 Interactive directed graph showing how pathophysiology mechanisms, phenotypes, genetic factors and variants, experimental models, environmental triggers, and treatments relate through causal and linked edges.
●

Phenotypes

5
Sensorineural hearing impairment OBLIGATE Auditory HP:0000407 Human Phenotype Ontology (HP) Relation: this clinical feature is this phenotype This clinical feature is Sensorineural hearing impairment (HP:0000407). HP:0000407 is a phenotype from the Human Phenotype Ontology.
Show evidence (4 references)
PMID:23023331 SUPPORT Human Clinical
"One mutation in CIB2 is a prevalent cause of deafness DFNB48 in Pakistan; other CIB2 mutations contribute to deafness elsewhere in the world."
Establishes CIB2 as a cause of DFNB48 deafness both in the founder population and beyond it.
PMID:29112224 SUPPORT Human Clinical
"Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all frequencies in all affected individuals."
Audiometric characterisation across a multi-ethnic ARNSHL cohort, giving laterality, symmetry, onset, severity and frequency involvement in one measured statement.
PMID:26173970 SUPPORT Human Clinical
"Affected individuals of Pakistani family W09-1575 (Figure 1a) were diagnosed with prelingual, bilateral, moderate-to-severe sensorineural HI"
The clinical spectrum includes moderate-to-severe loss.
+ 1 more reference
Profound sensorineural hearing impairment Auditory HP:0011476 Human Phenotype Ontology (HP) Relation: this clinical feature is this phenotype This clinical feature is Profound sensorineural hearing impairment (HP:0011476). HP:0011476 is a phenotype from the Human Phenotype Ontology.
Show evidence (3 references)
PMID:29112224 SUPPORT Human Clinical
"Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all frequencies in all affected individuals."
Establishes severe-to-profound severity across all affected individuals in the cohort.
PMID:26173970 SUPPORT Human Clinical
"deafness segregating with the c.272T>C variant in one Pakistani family is remarkably less severe than that in all other families with this mutation"
Documents variable expressivity directly: the same recurrent allele gives markedly different severity between families, so severity is not fixed by genotype.
PMID:26173970 SUPPORT Human Clinical
"In another Pakistani family W09-1600 the HI was profound, prelingual, bilateral and sensorineural"
This family establishes profound severity directly; other families have less severe hearing loss.
Prelingual sensorineural hearing impairment Auditory HP:0000399 Human Phenotype Ontology (HP) Relation: this clinical feature is this phenotype This clinical feature is Prelingual sensorineural hearing impairment (HP:0000399). HP:0000399 is a phenotype from the Human Phenotype Ontology.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all frequencies in all affected individuals."
Establishes prelingual onset by audiometry in every affected individual in the cohort.
Bilateral sensorineural hearing impairment Auditory HP:0008619 Human Phenotype Ontology (HP) Relation: this clinical feature is this phenotype This clinical feature is Bilateral, symmetric sensorineural hearing loss across all frequencies, annotated with Bilateral sensorineural hearing impairment (HP:0008619). HP:0008619 is a phenotype from the Human Phenotype Ontology.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all frequencies in all affected individuals."
Establishes bilaterality, symmetry and pan-frequency involvement in the same audiometric statement.
Congenital sensorineural hearing impairment Auditory HP:0008527 Human Phenotype Ontology (HP) Relation: this clinical feature is this phenotype This clinical feature is Congenital sensorineural hearing impairment (HP:0008527). HP:0008527 is a phenotype from the Human Phenotype Ontology.
Show evidence (1 reference)
PMID:26173970 SUPPORT Human Clinical
"Both individuals of Dutch family 07-1069 (Figure 1c) were diagnosed with congenital, profound sensorineural hearing loss as they both failed the neonatal hearing screening."
The two siblings provide direct evidence of congenital onset.
🧬

Genetic Associations

1
CIB2
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this disease-associated gene is this gene This disease-associated gene is CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee. relationship_type: CAUSATIVE
Show evidence (2 references)
PMID:29112224 SUPPORT Human Clinical
"We expand the mutational spectrum of CIB2 to include copy number variations (CNVs), splice-site variants and indels"
Documents the breadth of the CIB2 allelic spectrum beyond point variants.
PMID:28663585 SUPPORT Model Organism
"we generated a p.F91S missense mutation knockin mouse"
Identifies p.F91S as the allele chosen for modelling because it is a recurrent Pakistani founder allele.
Variants (12)
c.272T>C (p.Phe91Ser)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Recurrent Pakistani founder allele, homozygous in 54 DFNB48 families in the founding study. Moderate-to-severe and profound hearing loss have both been reported in families carrying this allele. The corresponding mouse knock-in loses cochlear MET despite preserved localization of mutant CIB2.
Show evidence (2 references)
PMID:23023331 SUPPORT Human Clinical
"in affected subjects in 54 DFNB48 Pakistani families, we found a homozygous mutation (c.272T>C; p.Phe91Ser) of CIB2"
Reports the ascertainment count for the founding series, not population prevalence.
PMID:26173970 SUPPORT Human Clinical
"deafness segregating with the c.272T>C variant in one Pakistani family is remarkably less severe than that in all other families with this mutation"
Variable expressivity limits severity prediction from this genotype alone.
c.297C>G (p.Cys99Trp)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Missense variant segregating with deafness in two Pakistani families; linked haplotypes supported a founder effect.
Show evidence (2 references)
PMID:23023331 SUPPORT Human Clinical
"in two DFNB48 families (DEM4025, DEM4225) a c.297C>G (p.Cys99Trp) CIB2 mutation co-segregated with deafness"
Human segregation evidence.
PMID:23023331 SUPPORT Human Clinical
"the flanking haplotypes were consistent with a founder effect for both alleles"
Refers to the recurrent c.272T>C and c.297C>G alleles in the same paragraph.
c.368T>C (p.Ile123Thr)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Missense allele segregating with nonsyndromic hearing loss in a Turkish family. The corresponding knock-in mouse has abolished early cochlear MET currents.
Show evidence (2 references)
PMID:23023331 SUPPORT Human Clinical
"a transition mutation c.368T>C (p.Ile123Thr) of CIB2 co-segregated with ARNSHI in Turkish DFNB48 family 802"
Clinical segregation is distinct from subsequent knock-in experiments.
PMID:34089643 SUPPORT Model Organism
"MET currents were abolished in OHC from Cib2I123T/I123T mice"
Functional loss in the allele-specific mouse model.
c.196C>T (p.Arg66Trp)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Reported in homozygous and compound heterozygous genotypes, including in trans with c.300_309del in Trio-B.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"Compound heterozygous variants in CIB2: c.196C>T; p.Arg66Trp and c.300_309del; p.Glu100fs*28 were identified in the proband of family Trio-B"
Directly documents the frameshift allele in trans.
c.198+1G>A
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Homozygous canonical splice-site variant in family 51550. Exon-3 donor loss was predicted computationally, rather than established by a patient RNA assay. The proband underwent bilateral cochlear implantation.
Show evidence (2 references)
PMID:29112224 SUPPORT Human Clinical
"An ultra-rare homozygous splice-site variant in CIB2, c.198+1G>A, was identified in the proband of 51550"
Clinical genotype finding.
PMID:29112224 SUPPORT Computational
"Computation splice-site predictions predicted the loss of the wild-type donor site of exon 3 in transcript 1"
Splice consequence is predicted.
c.300_309del (p.Glu100fs*28)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Frameshift allele found in trans with p.Arg66Trp in Trio-B. The predicted truncation affects the coding sequence of all four transcripts described in the study.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"The second allele, c.300_309del is a rare frameshift variant that predicts a null allele and affects the coding sequence of all four transcripts"
Reported variant and predicted consequence; protein absence was not directly measured.
CIB2 exon-2 deletion (p.Asp18Alafs*7)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
A homozygous 3113-bp deletion in Iranian family L-3156 removes coding exon 2 from transcripts 1 and 4. Read-depth inspection, PCR and breakpoint analysis identified the deletion; a frameshift and premature stop were predicted for these transcripts.
Show evidence (2 references)
PMID:29112224 SUPPORT Human Clinical
"The size of the deletion was determined to be 3113 bp with the breakpoints at chr15:78413407 and Chr15:78416520"
Breakpoint coordinates refer to the study reference genome, not a universal coordinate assembly.
PMID:29112224 SUPPORT Human Clinical
"This CNV removes the coding exon 2 (c.52_86delGACTGCACCTTCTTCAATAAGAAGGACATCCTCAA) from transcripts 1 and 4"
Defines the affected exon and transcript scope.
c.344A>G (p.Tyr115Cys)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Homozygous missense variant segregating with nonsyndromic hearing loss in Iranian family L-1644.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"This novel missense variant changes a conserved tyrosine residue to a cysteine, p.Tyr115Cys"
Variant identified and segregated in the clinical family.
c.330T>A (p.Tyr110Ter)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Nonsense allele associated with nonsyndromic hearing loss. It affects the coding sequences of all four CIB2 transcripts described in the study.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"A homozygous nonsense variant in CIB2, c.330T>A, p.Tyr110Terwas identified in the proband of family 661 and was found to segregate with the hearing loss in the family"
Retains the source typography at the join between the protein variant and the verb.
c.34C>T (p.Gln12Ter)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Homozygous nonsense allele reported in Iranian family L-700 with nonsyndromic hearing loss. This early stop affects a subset of CIB2 isoforms; it is not automatically an experimentally confirmed absence of every isoform.
Show evidence (1 reference)
url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/ SUPPORT Human Clinical
"This variant resulted in a premature stop codon at position 12 of the protein (p.Gln12*)"
Family L-700 variant identified through molecular testing and segregation.
c.97C>T (p.Arg33Ter)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Nonsense allele found in trans with p.Arg66Trp in two Dutch siblings with congenital profound hearing loss. It affects some CIB2 isoforms; nonsense-mediated decay was predicted rather than directly measured.
Show evidence (1 reference)
PMID:26173970 SUPPORT Human Clinical
"variants in the two affected children are present in the compound heterozygous state (c.[97C>T][196C>T])."
Parental testing and Sanger confirmation support the compound heterozygous genotype.
c.223G>A (p.Val75Met)
Gene: CIB2 hgnc:24579 HUGO Gene Nomenclature Committee (hgnc) Relation: this variant is in this gene This variant is in CIB2 (hgnc:24579). hgnc:24579 is a gene from the HUGO Gene Nomenclature Committee.
Homozygous missense allele identified in the proband of Trio-C with nonsyndromic hearing loss.
Show evidence (1 reference)
PMID:29112224 SUPPORT Human Clinical
"a homozygous previously reported pathogenic alteration in CIB2: c.223G>A; p.Val75Met was identified"
Reported genotype in Trio-C.
💊

Medical Actions

6
Cochlear Implantation
Action: cochlear device implantationNCI Thesaurus (NCIT) Relation: this treatment is this clinical intervention This treatment is cochlear device implantation, annotated with Surgical Procedure (NCIT:C15329), qualified as medical device cochlear implant. NCIT:C15329 is a clinical intervention from the NCI Thesaurus. Ontology label: Surgical Procedure NCIT:C15329
Platform: Device
Cochlear implantation provides auditory habilitation for eligible people with severe-to-profound DFNB48 hearing loss. Two Dutch siblings received implants with good reported results, and a child homozygous for c.198+1G>A underwent successful bilateral implantation at 13 months. These are individual clinical reports, not a genotype-specific outcome rate.
Mechanism Target:
Impaired Cochlear Mechanoelectrical Transduction — Substitutes electrical stimulation of the cochlear nerve for impaired hair-cell mechanotransduction, without restoring the transduction step itself.
Show evidence (3 references)
PMID:26173970 SUPPORT Human Clinical
"Both hearing-impaired members of family 07-1069 received a cochlear implant with good results."
Direct CIB2-specific outcomes in two siblings.
PMID:29112224 SUPPORT Human Clinical
"The proband of family 51550 underwent bilateral cochlear implantation at 13 months"
Direct clinical timing in the splice-site family.
PMID:29112224 SUPPORT Human Clinical
"A patient carrying this variant underwent successful bilateral cochlear implant implantation"
The discussion reports a successful outcome for the c.198+1G>A proband.
Hearing Aids and Auditory Rehabilitation
Action: auditory rehabilitation with amplificationNCI Thesaurus (NCIT) Relation: this treatment is this clinical intervention This treatment is auditory rehabilitation with amplification, annotated with Rehabilitation (NCIT:C15315), qualified as medical device hearing aid. NCIT:C15315 is a clinical intervention from the NCI Thesaurus. Ontology label: Rehabilitation NCIT:C15315
Platform: Device
Hearing aids can support useful residual hearing, with fitting based on individual audiometry. Communication support, including sign language when desired, should be individualized. These are general genetic hearing-loss approaches; CIB2-specific hearing-aid outcomes were not established in the cited guidance.
Show evidence (2 references)
url:https://www.ncbi.nlm.nih.gov/books/NBK1434/ SUPPORT INDIRECT Other
"customized by an audiologist to the degree and frequency of hearing loss, can be used in individuals with mild-to-severe hearing loss."
General hearing-loss guidance applicable to residual hearing, including the less severe DFNB48 spectrum.
url:https://www.ncbi.nlm.nih.gov/books/NBK1434/ SUPPORT INDIRECT Other
"Habilitation for hearing loss includes improved access to sound through hearing aids or cochlear implants and, when desired, exposure to and teaching of American Sign Language."
General communication and habilitation options, rather than a gene-specific efficacy study.
Auditory-Verbal Therapy
Action: speech therapyNCI Thesaurus (NCIT) Relation: this treatment is this clinical intervention This treatment is speech therapy, annotated with Speech Language Therapy (NCIT:C159273). NCIT:C159273 is a clinical intervention from the NCI Thesaurus. Ontology label: Speech Language Therapy NCIT:C159273
Platform: Behavioral / lifestyle
Speech-language and auditory habilitation can support communication after implantation, individualized to the person and family. A general pediatric implant cohort associated appointment attendance with language outcomes; that observational association does not establish a CIB2-specific treatment effect or separate therapy exposure from family factors.
Mechanism Target:
Sensorineural hearing impairment — Addresses the language consequence of the sensory deficit rather than the cochlear lesion, by training use of the restored auditory input.
Show evidence (1 reference)
PMID:42330611 SUPPORT INDIRECT Human Clinical
"Higher appointment attendance was consistently associated with more favorable language outcomes following pediatric cochlear implantation."
General pediatric implant cohort; the association is observational and not specific to CIB2.
Genetic Counseling
Action: Genetic CounselingNCI Thesaurus (NCIT) Relation: this treatment is this clinical intervention This treatment is Genetic Counseling (NCIT:C15240). NCIT:C15240 is a clinical intervention from the NCI Thesaurus. NCIT:C15240
Platform: Other
Counseling follows confirmation of the molecular diagnosis and parental segregation. If both parents carry a pathogenic CIB2 allele, each pregnancy has a 25% chance of biallelic hearing loss, a 50% chance of carrier status and a 25% chance of inheriting neither familial allele. The disputed historical Usher assignment should not be presented as an established prediction of blindness for DFNB48.
Show evidence (1 reference)
url:https://www.ncbi.nlm.nih.gov/books/NBK1434/ SUPPORT INDIRECT Other
"has at conception a 25% chance of having hearing loss, a 50% chance of having no hearing loss"
General recessive hearing-loss counseling, conditional on both parents being confirmed carriers.
Experimental AAV-CIB2 Gene Augmentation
Action: Gene TherapyNCI Thesaurus (NCIT) Relation: this treatment is this clinical intervention This treatment is Gene Therapy (NCIT:C15238). NCIT:C15238 is a clinical intervention from the NCI Thesaurus. NCIT:C15238
Platform: Gene therapy
Preclinical gene augmentation with AAV2.Anc80L65 carrying mouse Cib2 partially restored cochlear architecture and hearing in Cib2-null mice treated at P0-P4. P6 treatment did not improve hearing with this construct. In P0-P1-treated null mice, benefit persisted to 24 weeks and was strongest at lower frequencies; high-frequency recovery was limited. P0-treated F91S knock-in mice retained partial low-frequency benefit to P60, the last tested time. These mouse studies do not establish human efficacy, safety or a prenatal treatment window.
Mechanism Target:
CIB2 Loss of Function — Supplies functional CIB2 in cochlear hair cells.
Failure to Restrict Transducing Stereocilia Growth — Partially restores bundle architecture in treated mouse cochleae.
Show evidence (4 references)
PMID:42427029 SUPPORT Model Organism
"We observed sustained, but partial, recovery of hearing function and restoration of stereocilia architecture in the apical to middle cochlear turns in mice having received AAV-Cib2 between postnatal day 0 (P0) and P4."
Reports the rescue with its two important limits stated by the authors themselves: the recovery is partial and restricted to apical-to-middle turns, and it depends on treating within a narrow postnatal window.
PMID:42427029 SUPPORT Model Organism
"no improvement in ABR thresholds (Figure 3B) or stereocilia bundle morphology was observed in Cib2ko/ko mice injected with Anc80.CIB2.GFP.WPRE at P6"
No rescue at the tested later age with this construct; not a universal point of irreversibility.
PMID:42427029 SUPPORT Model Organism
"which persisted out to the latest time point tested, 24 weeks after injection"
Duration of partial rescue in the null model.
+ 1 more reference
Experimental AAV-CIB3 Compensation
Action: Gene TherapyNCI Thesaurus (NCIT) Relation: this treatment is this clinical intervention This treatment is Gene Therapy (NCIT:C15238). NCIT:C15238 is a clinical intervention from the NCI Thesaurus. NCIT:C15238
Platform: Gene therapy
AAV2.Anc80L65 delivery of human CIB3 at P0-P1 partially restored hearing in Cib2-null mice and improved hair-cell survival at P45. This is paralogue compensation rather than replacement of the mutated CIB2 gene. Increasing endogenous CIB3 with transcriptional activation or small molecules remains a proposed strategy without demonstrated clinical efficacy.
Mechanism Target:
Impaired Cochlear Mechanoelectrical Transduction — Provides a paralogue able to substitute for CIB2 in the mouse cochlea.
Show evidence (2 references)
PMID:42427029 SUPPORT Model Organism
"overexpression of CIB3 via Anc80.CIB3.GFP.WPRE injection at P0–P1 restored persistent hearing function in Cib2ko/ko mice"
Human CIB3 cDNA was delivered to mice; this is not a human treatment result.
PMID:42427029 SUPPORT Model Organism
"administration of Anc80.CIB3.GFP.WPRE significantly improved survival of both IHCs and OHCs in Cib2ko/ko mice at P45"
Hair-cell survival outcome was measured against GFP-vector controls.
🔬

Diagnosis

2
Genetic testing in bilateral prelingual sensorineural hearing loss
Molecular testing identifies biallelic disease-causing CIB2 variants in the context of the auditory phenotype and segregation. Hearing-loss panels or genomic testing should include assessment for exon-level copy-number changes: one CIB2 family was resolved only after recognizing absent exon-2 sequence coverage and confirming a deletion by PCR. A variant of uncertain significance alone does not establish DFNB48.
Show evidence (3 references)
PMID:29112224 SUPPORT Human Clinical
"Assessing the coverage for each gene in the region using IGV revealed absence of sequence reads mapping to exon 2 of CIB2"
Exon-level read-depth review identified a deletion missed by the initial small-variant candidate list.
PMID:29112224 SUPPORT Human Clinical
"Long-range PCR found the deletion to segregate with hearing loss in the extended family"
Orthogonal confirmation and segregation supported the molecular diagnosis.
url:https://www.ncbi.nlm.nih.gov/books/NBK1434/ SUPPORT Other
"can often identify the cause of genetic hearing loss while limiting identification of"
The quoted clause describes a multigene hearing-loss panel. The source separately cautions that variants of uncertain significance cannot establish or exclude a diagnosis.
Audiological characterization and pre-implant imaging
Audiometry and auditory brainstem responses characterize bilateral sensorineural loss. Neonatal screening detected congenital loss in two CIB2 siblings. Temporal-bone CT was normal in reported Dutch cases and in the child from family 51550; normal imaging supports implant assessment but does not distinguish DFNB48 from other genetic hearing losses.
Show evidence (2 references)
PMID:26173970 SUPPORT Human Clinical
"During BERA no responses were found for both individuals."
Auditory brainstem testing in the two siblings who failed neonatal screening.
PMID:29112224 SUPPORT Human Clinical
"his preoperative temporal bone computed tomography showed normal cochlear anatomy."
Clinical imaging in the implanted child from family 51550.
📊

Prevalence

1
Pakistani consanguineous hearing-loss cohorts
Unknown Unknown
No population prevalence figure for DFNB48 specifically is available. The locus was mapped and is most often reported in consanguineous Pakistani families, so the case series are ascertainment-driven rather than population-based, and no rate is asserted here.
Show evidence (1 reference)
PMID:30303587 SUPPORT Human Clinical
"The five most common HL genes in the Pakistani population are SLC26A4, MYO7A, GJB2, CIB2 and HGF, respectively."
Places CIB2 among the five most common hearing-loss genes in this population. A rank within an ascertained clinical cohort, not a population rate, which is why no rate_per_100000 is asserted.
🐁

Animal Models

3
Cib2 knockout mouse
Constitutive Cib2 null. Deaf, with mechanotransduction absent in auditory hair cells while tip links remain present, and with overgrowth of the shorter transducing stereocilia rows. Vestibular function is spared, matching the human non-syndromic phenotype.
Species
Mouse
Genotype
Cib2 null (tm1a gene-trap or tm1b exon-4 deletion; Cib2KO/KO)
Publication
PMID:28663585
Pathograph links
Impaired Cochlear Mechanoelectrical Transduction recapitulates fidelity: high observes: cellular Reproduces the experimentally demonstrated cochlear MET defect, including preserved tip links; equivalent human hair-cell electrophysiology was not reported.
Limitations: A constitutive null, whereas most reported human alleles are missense. Mouse cochlear TMC2 is replaced by TMC1 within the first postnatal days, so the developmental window differs from human.
Readouts
Mechanotransduction current in auditory hair cells
Direction: ABOLISHED
Interpretation: Direct electrophysiological measure of the node in this model.
Show evidence (1 reference)
PMID:34089643 SUPPORT Model Organism
"MET currents were abolished in Cib2-deficient OHCs"
Patch-clamp measurement of the abolished current in outer hair cells.
Show evidence (1 reference)
PMID:28663585 SUPPORT Model Organism
"exhibit no mechanotransduction in auditory hair cells, despite the presence of tip links that gate the mechanotransducer channels"
The result that makes this model informative for the node: transduction fails with the force-delivery apparatus intact.
Failure to Restrict Transducing Stereocilia Growth recapitulates fidelity: high observes: cellular Reproduces the stereocilia overgrowth arm.
Limitations: Bundle architecture was measured in mouse cochlea; these studies do not establish equivalent human temporal-bone histology.
Readouts
Shorter-row stereocilia length
Direction: INCREASED
Interpretation: Overgrowth of the transducing rows is the structural readout of this node.
Show evidence (1 reference)
PMID:28663585 SUPPORT Model Organism
"mechanotransducing shorter row stereocilia overgrow in hair cell bundles of both Cib2 mutants"
Direct measurement of the overgrowth in both mutant lines.
Cib2 p.F91S knock-in mouse
Carries the recurrent Pakistani founder allele p.Phe91Ser rather than a null, so it tests whether the disease missense variant, and not merely absence of the protein, causes the phenotype. It does: these mice are deaf with the same transduction and bundle defects.
Species
Mouse
Genotype
Cib2 p.Phe91Ser knock-in (Cib2F91S/F91S)
Publication
PMID:28663585
Pathograph links
CIB2 Loss of Function recapitulates fidelity: high observes: molecular Models a recurrent human missense allele, allowing comparison with complete loss of CIB2.
Limitations: Models one recurrent founder allele. Other disease-associated missense alleles have distinct effects on TMC binding, localization and residual channel activity.
Show evidence (1 reference)
PMID:28663585 SUPPORT Model Organism
"we generated a p.F91S missense mutation knockin mouse"
Establishes that the model carries the prevalent human deafness allele.
Cib2 CRISPR exon-4 knockout mouse
Independent CRISPR knockout mice have absent cochlear MET before marked bundle deterioration. The endocochlear potential remains normal. Voltage-gated outer hair-cell currents are modestly reduced at P7 but not at P1 or P4; their contribution to deafness is unresolved. Reverse-polarity currents remain detectable, distinguishing conventional MET loss from loss of every mechanically evoked current.
Species
Mouse
Genotype
Cib2 exon-4 deletions introducing a premature stop
Publication
PMID:29255404
Pathograph links
Impaired Cochlear Mechanoelectrical Transduction recapitulates fidelity: high observes: cellular Independent allele corroborates absent conventional MET in early auditory hair cells.
Limitations: Mouse electrophysiology does not measure residual current in human DFNB48.
Show evidence (4 references)
PMID:29255404 SUPPORT Model Organism
"MET currents are also absent in P7 Cib2 knockout IHCs"
The same study reports absent outer hair-cell MET at P1, P4 and P7.
+ 3 more references
{ }

Source YAML

click to show 
name: Autosomal Recessive Nonsyndromic Hearing Loss 48
category: Mendelian
creation_date: '2026-09-04T00:00:00Z'
synonyms:
- DFNB48
- deafness, autosomal recessive 48
- autosomal recessive nonsyndromic deafness 48
- CIB2-related nonsyndromic hearing loss
description: >-
  DFNB48 is autosomal recessive nonsyndromic sensorineural hearing loss caused by biallelic CIB2 variants.
  Hearing loss is bilateral and prelingual, including documented congenital cases, and is usually severe
  to profound; moderate-to-severe hearing loss has also been reported. CIB2 is an auxiliary component
  of the cochlear hair-cell mechanoelectrical transduction (MET) complex. Experimental loss of CIB2 impairs
  TMC1/TMC2 localization and channel function, with additional abnormalities of stereocilia maintenance
  and later hair-cell degeneration. Missense alleles differ in their effects on residual channel function.
  CIB3 can compensate in vestibular hair cells in mouse models, whereas its low cochlear expression does
  not prevent deafness. Later clinical series challenge the original assignment of CIB2 to Usher syndrome;
  vestibular compensation does not itself establish the absence of retinal disease.
disease_term:
  preferred_term: autosomal recessive nonsyndromic hearing loss 48
  term:
    id: MONDO:0012273
    label: autosomal recessive nonsyndromic hearing loss 48
parents:
- Autosomal Recessive Nonsyndromic Hearing Loss
references:
- reference: PMID:29112224
  title: Variants in CIB2 cause DFNB48 and not USH1J.
- reference: PMID:23023331
  title: >-
    Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and nonsyndromic
    deafness DFNB48.
- reference: PMID:28663585
  title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
- reference: PMID:39773557
  title: Complexes of vertebrate TMC1/2 and CIB2/3 proteins form hair-cell mechanotransduction cation channels.
- reference: PMID:40000792
  title: Structural insights into calcium-dependent CIB2-TMC1 interaction in hair cell mechanotransduction.
- reference: PMID:34089643
  title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
- reference: PMID:40083274
  title: CIB2 function is distinct from that of whirlin in the organization of sterocilia architecture.
- reference: PMID:26173970
  title: >-
    Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium buffering
    and localization in hair cells.
- reference: url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/
  title: CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival - PMC
- reference: PMID:37001993
  title: >-
    CIB2 and CIB3 Regulate Stereocilia Maintenance and Mechanoelectrical Transduction in Mouse Vestibular
    Hair Cells.
- reference: PMID:42427029
  title: >-
    Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
    of recessive deafness DFNB48.
- reference: PMID:30303587
  title: Global genetic insight contributed by consanguineous Pakistani families segregating hearing loss.
- reference: url:https://www.ncbi.nlm.nih.gov/books/NBK1434/
  title: Genetic Hearing Loss Overview - GeneReviews® - NCBI Bookshelf
  tags:
  - GeneReviews
- reference: PMID:42330611
  title: >-
    Language outcomes following pediatric cochlear implantation: Associations with clinical, socioeconomic,
    and rehabilitation factors.
- reference: PMID:29255404
  title: Loss of CIB2 Causes Profound Hearing Loss and Abolishes Mechanoelectrical Transduction in Mice.
- reference: PMID:29084757
  title: CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival.
- reference: PMID:34162842
  title: CIB2 regulates mTORC1 signaling and is essential for autophagy and visual function.
inheritance:
- name: Autosomal recessive
  description: >-
    Biallelic CIB2 variants; heterozygous carriers are unaffected. The locus was mapped in consanguineous
    Pakistani families and most reported affected individuals are homozygous, though compound heterozygotes
    and a pathogenic variant in trans with a frameshift are also described.
  inheritance_term:
    preferred_term: Autosomal recessive inheritance
    term:
      id: HP:0000007
      label: Autosomal recessive inheritance
  evidence:
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Of the 6 families we ascertained, 3 segregated novel loss-of-function (LOF) variants, 2 families
      segregated missense variants (1 novel) and 1 family segregated a previously reported pathogenic
      variant in trans with a frameshift variant.
    explanation: >-
      Documents biallelic segregation across six families and the range of allele combinations seen, including
      compound heterozygosity.
  - reference: PMID:23023331
    reference_title: >-
      Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and nonsyndromic
      deafness DFNB48.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      The four recessive mutations of CIB2 co-segregate with deafness or deaf-blindness while carriers
      have normal hearing.
    explanation: >-
      Segregation and carrier hearing support recessive inheritance; the historical syndromic assignment
      is considered separately.
pathophysiology:
- name: CIB2 Loss of Function
  description: >-
    Biallelic CIB2 variants reduce or abolish the function of the auxiliary MET-channel protein. Human
    disease alleles include missense, nonsense, frameshift, splice-site and exon-deletion variants. Null
    and missense knock-in mice support loss of function, but different missense alleles retain different
    degrees of TMC binding and channel activity; a simple N-terminal binding versus C-terminal calcium-buffering
    division does not describe the later functional evidence.
  biological_scale: MOLECULAR
  mechanism_confidence: ESTABLISHED
  genes:
  - preferred_term: CIB2
    term:
      id: hgnc:24579
      label: CIB2
  downstream:
  - target: Disrupted CIB2-TMC1/TMC2 Association at the MET Channel
    causal_link_type: DIRECT
  - target: Failure to Restrict Transducing Stereocilia Growth
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
  - target: Cochlear Hair Cell Apoptosis
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
    description: Apoptosis follows CIB2 loss in mice; the intervening death-signaling pathway is unresolved.
  evidence:
  - reference: PMID:28663585
    reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      we have characterized two mutant mouse lines, one lacking calcium and integrin-binding protein 2
      and one carrying a human deafness-related Cib2 mutation, and show that both are deaf
    explanation: >-
      Establishes that both a null allele and a human disease missense allele produce deafness in mouse,
      supporting loss of function as the disease mechanism.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      We expand the mutational spectrum of CIB2 to include copy number variations (CNVs), splice-site
      variants and indels
    explanation: Human families extend the allelic spectrum beyond missense substitutions.
- name: Disrupted CIB2-TMC1/TMC2 Association at the MET Channel
  description: >-
    CIB2 interacts with both the N-terminal cytoplasmic domain and the first intracellular loop of TMC1.
    Purified-protein NMR supports simultaneous binding to the two regions; crystallography and biochemical
    assays resolve distinct interfaces. Deafness-associated substitutions have allele- and assay-dependent
    effects on these interactions. Calcium-dependent fragment-binding results support a calcium-sensing
    role, but do not by themselves establish channel adaptation kinetics in hair cells. In 2025 fragment-binding
    assays, F91S strongly impaired binding to the N-terminal site, while I123T predominantly impaired
    binding to the intracellular-loop site under calcium-containing conditions. These specific effects
    do not imply that other interfaces or full-length protein interactions are normal.
  biological_scale: MOLECULAR
  mechanism_confidence: ESTABLISHED
  cellular_components:
  - preferred_term: hair cell stereocilium
    term:
      id: GO:0032420
      label: stereocilium
  downstream:
  - target: Reduced Stereociliary TMC1/TMC2 Localization
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
  - target: Altered MET Channel Resting Open Probability
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
  evidence:
  - reference: PMID:28663585
    reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: >-
      we report that calcium and integrin-binding protein 2 binds to the components of the hair cell mechanotransduction
      complex, TMC1 and TMC2, and these interactions are disrupted by deafness-causing Cib2 mutations.
    explanation: Protein interaction experiments used transfected cells, distinct from the mouse auditory phenotype.
  - reference: PMID:39773557
    reference_title: Complexes of vertebrate TMC1/2 and CIB2/3 proteins form hair-cell mechanotransduction cation channels.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: Here, we show using NMR that both TMC1-NT and TMC1-IL1 bind to CIB2 and CIB3 non-competitively.
    explanation: NMR with purified human protein fragments supports two simultaneous interactions.
  - reference: PMID:40000792
    reference_title: Structural insights into calcium-dependent CIB2-TMC1 interaction in hair cell mechanotransduction.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: these variants have differential impacts on CIB2's interactions with TMC1's dual binding sites
    explanation: >-
      Biochemical testing of disease-associated substitutions does not support a uniform regional division
      of variant effects.
  - reference: PMID:40000792
    reference_title: Structural insights into calcium-dependent CIB2-TMC1 interaction in hair cell mechanotransduction.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: the F91S mutation in CIB2 almost entirely negated binding to TMC1CBD-1
    explanation: Direct purified-protein assay for the N-terminal binding region.
  - reference: PMID:40000792
    reference_title: Structural insights into calcium-dependent CIB2-TMC1 interaction in hair cell mechanotransduction.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: >-
      the I123T mutation, which had little effect on TMC1CBD-1 binding, substantially hindered TMC1CBD-2
      binding in the presence of 0.5 mM Ca2+
    explanation: Distinct effect on the intracellular-loop fragment at the assay calcium concentration.
  - reference: PMID:40000792
    reference_title: Structural insights into calcium-dependent CIB2-TMC1 interaction in hair cell mechanotransduction.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: direct interaction exists between CIB2 1-187 and TMC1CBD-2 in 0.5 mM Ca2+ buffer condition.
    explanation: Supports calcium-dependent fragment binding; it is not a physiological calcium-threshold measurement.
- name: Reduced Stereociliary TMC1/TMC2 Localization
  description: >-
    In Cib2-null mouse cochlear hair cells, endogenously tagged TMC1 and TMC2 are undetectable in stereocilia
    even though TMC1 remains in the cell body. Missense alleles can affect TMC1 more strongly than TMC2.
    These experiments establish a localization defect without distinguishing failed trafficking from failed
    retention of an incompletely assembled complex. They supersede earlier antibody-based localization
    results that appeared normal.
  biological_scale: CELLULAR
  mechanism_confidence: ESTABLISHED
  cellular_components:
  - preferred_term: hair cell stereocilium
    term:
      id: GO:0032420
      label: stereocilium
  downstream:
  - target: Impaired Cochlear Mechanoelectrical Transduction
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
  evidence:
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      Localization of TMC1 and TMC2 to stereocilia was detected in heterozygous Cib2+/− control mice but
      was undetectable in Cib2−/− mice
    explanation: >-
      Endogenous epitope-tag knock-in experiments between P4 and P8 localize the defect to stereociliary
      channel availability.
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: TMC1 was still expressed in the cell body of Cib2−/− mutant mice
    explanation: Loss of stereociliary signal does not mean absence of all cellular TMC1.
- name: Altered MET Channel Resting Open Probability
  description: >-
    Residual MET channels in Cib2 E64D and R186W knock-in mice have increased resting open probability.
    In R186W mice lacking TMC1, TMC2-dependent currents show altered resting open probability and modest
    changes in unitary conductance and calcium selectivity. Adaptation kinetics and extent were not significantly
    changed in that preparation, so altered resting gating is distinct from a demonstrated defect in adaptation.
  biological_scale: MOLECULAR
  mechanism_confidence: ESTABLISHED
  downstream:
  - target: Impaired Cochlear Mechanoelectrical Transduction
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
  evidence:
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: CIB2 affects channel resting Po without effects on adaptation.
    explanation: The authors distinguish channel resting state from adaptation in the tested TMC2-dependent preparation.
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      These changes in protein:protein interactions might also explain the moderate changes in ion selectivity
      and single channel conductance observed in OHCs
    explanation: >-
      Electrophysiological changes were measured; their explanation by altered interaction geometry remains
      a hypothesis.
- name: Impaired Cochlear Mechanoelectrical Transduction
  description: >-
    Cochlear MET currents are absent in Cib2-null, F91S and I123T mouse models, but severely reduced rather
    than absent in E64D and R186W knock-ins. The latter retain early TMC2-dependent function despite deafness.
    In null and F91S models, failure of MET occurs while tip links are still present and before extensive
    hair-cell loss. The primary transduction defect therefore does not require prior cell death.
  biological_scale: CELLULAR
  mechanism_confidence: ESTABLISHED
  cell_types:
  - preferred_term: cochlear hair cell
    term:
      id: CL:0000202
      label: auditory hair cell
  biological_processes:
  - preferred_term: detection of mechanical stimulus involved in sensory perception of sound
    modifier: DECREASED
    term:
      id: GO:0050910
      label: detection of mechanical stimulus involved in sensory perception of sound
  locations:
  - preferred_term: organ of Corti
    term:
      id: UBERON:0002227
      label: spiral organ of cochlea
  downstream:
  - target: Sensorineural hearing impairment
    causal_link_type: DIRECT
    description: Experimental channel failure provides a mechanistic explanation for the clinical hearing deficit.
  - target: Profound sensorineural hearing impairment
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
    description: >-
      Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect
      expression.
  - target: Prelingual sensorineural hearing impairment
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
    description: >-
      Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect
      expression.
  - target: Bilateral sensorineural hearing impairment
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
    description: >-
      Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect
      expression.
  - target: Congenital sensorineural hearing impairment
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
    description: >-
      Clinical phenotype linked to the cochlear sensory defect; genotype and developmental context affect
      expression.
  evidence:
  - reference: PMID:28663585
    reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      exhibit no mechanotransduction in auditory hair cells, despite the presence of tip links that gate
      the mechanotransducer channels
    explanation: >-
      The dissociation that localises the defect to the channel complex rather than the tip-link force-transmission
      apparatus.
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: MET currents were abolished in Cib2-deficient OHCs
    explanation: Independent electrophysiological confirmation in outer hair cells.
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      MET currents were abolished in OHC from Cib2I123T/I123T mice (Fig. 7B), and were severely reduced,
      in Cib2E64D/E64D and Cib2R186W/R186W mice
    explanation: Knock-in electrophysiology distinguishes complete loss from hypomorphic channel function.
- name: Failure to Restrict Transducing Stereocilia Growth
  description: >-
    Shorter transducing stereocilia rows overgrow in Cib2 mutant mice, followed by broader bundle disorganization
    and regression. This growth phenotype differs from the retraction expected after MET-current loss,
    supporting an additional bundle-maintenance role. CIB2 physically interacts with WHRN, and MYO15A
    accumulates abnormally at first-row tips. WHRN overexpression fails to rescue Cib2-null bundles, and
    Cib2/Whrn double-null bundles show predominantly Whrn-like abnormalities with some superimposed Cib2
    features. These findings support distinct functions but do not exclude every role for WHRN in CIB2-dependent
    maintenance. Local calcium regulation and GPSM2-GNAI participation remain hypotheses; bulk calcium
    responses in transfected cells do not settle local stereociliary calcium mechanisms.
  biological_scale: CELLULAR
  mechanism_confidence: ESTABLISHED
  cellular_components:
  - preferred_term: stereocilium
    term:
      id: GO:0032420
      label: stereocilium
  biological_processes:
  - preferred_term: auditory receptor cell stereocilium organization
    modifier: DECREASED
    term:
      id: GO:0060088
      label: auditory receptor cell stereocilium organization
  downstream:
  - target: Cochlear Hair Cell Apoptosis
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
    description: Bundle abnormalities precede hair-cell loss in mouse models; the intervening death pathway is unresolved.
  evidence:
  - reference: PMID:28663585
    reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: mechanotransducing shorter row stereocilia overgrow in hair cell bundles of both Cib2 mutants
    explanation: Documents the stereocilia overgrowth phenotype in both mutant lines.
  - reference: PMID:40083274
    reference_title: CIB2 function is distinct from that of whirlin in the organization of sterocilia architecture.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: We found that the EF2 domain of CIB2 binds to the HHD2 region of WHRN.
    explanation: >-
      Transfected-cell interaction assays identify physical binding; binding alone does not establish
      a serial growth pathway.
  - reference: PMID:40083274
    reference_title: CIB2 function is distinct from that of whirlin in the organization of sterocilia architecture.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: Overexpression of WHRN in Cib2KO/KO mice did not rescue the stereocilia morphology.
    explanation: >-
      Failure of this rescue argues against simple compensation by WHRN overexpression, not against all
      WHRN participation.
  - reference: PMID:40083274
    reference_title: CIB2 function is distinct from that of whirlin in the organization of sterocilia architecture.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      in Cib2 mutants, the second- and third-row stereocilia are elongated, which is opposite to the expected
      retraction of transducing stereocilia that occurs after loss of MET current
    explanation: The direction of the growth phenotype supports a role beyond the MET-current defect.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: IN_VITRO
    snippet: do not affect the calcium-buffering ability of CIB2
    explanation: >-
      F91S and R66W did not change bulk ATP-evoked calcium responses in transfected COS-7 cells. This
      assay does not exclude local calcium-dependent mechanisms in stereocilia.
  - reference: PMID:40083274
    reference_title: CIB2 function is distinct from that of whirlin in the organization of sterocilia architecture.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: with overaccumulation at the tips of first-row stereocilia
    explanation: MYO15A immunolabeling was altered in Cib2-null cochlear hair cells.
- name: Cochlear Hair Cell Apoptosis
  description: >-
    Cib2-deficient mouse cochleae develop apoptotic hair-cell loss after the early transduction defect
    and bundle abnormalities. TUNEL-positive auditory hair cells were demonstrated at P20, supporting
    an apoptotic component. Outer hair-cell loss progresses before extensive inner hair-cell depletion
    in the models. The molecular route from CIB2 deficiency to apoptosis is unresolved; proposed ASK1
    or sphingosine-kinase signaling mechanisms have not been established in Cib2-deficient auditory hair
    cells.
  biological_scale: CELLULAR
  mechanism_confidence: ESTABLISHED
  cell_types:
  - preferred_term: cochlear hair cell
    term:
      id: CL:0000202
      label: auditory hair cell
  biological_processes:
  - preferred_term: apoptotic process
    modifier: INCREASED
    term:
      id: GO:0006915
      label: apoptotic process
  downstream:
  - target: Sensorineural hearing impairment
    causal_link_type: DIRECT
  - target: Secondary Spiral Ganglion Degeneration
    causal_link_type: INDIRECT_UNKNOWN_INTERMEDIATES
  evidence:
  - reference: url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/
    reference_title: CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival - PMC
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: dozens of hair cells displayed positive TUNEL staining in the cochlea
    explanation: >-
      The recovered full text reports TUNEL-positive cochlear hair cells in P20 Cib2-null mice and absent
      staining in heterozygous controls.
  - reference: url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/
    reference_title: CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival - PMC
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: It remains unclear how the absence of CIB2 leads to hair‐cell apoptosis
    explanation: The direct death-signaling mechanism remains unresolved.
- name: Secondary Spiral Ganglion Degeneration
  description: >-
    Progressive spiral ganglion neuron degeneration follows sensory hair-cell loss in Cib2 mutant mice.
    This later model finding is distinct from the primary transduction defect and does not establish neuronal
    degeneration in human DFNB48.
  biological_scale: TISSUE
  mechanism_confidence: ESTABLISHED
  evidence:
  - reference: PMID:28663585
    reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: The loss of sensory hair cells was followed by the progressive degeneration of spiral ganglion neurons
    explanation: >-
      Histology establishes the temporal sequence in mice; the intervening trophic or injury pathway was
      not resolved.
- name: CIB3 Paralogue Redundancy in Vestibular Hair Cells
  description: >-
    CIB2 and CIB3 have overlapping roles in vestibular hair-cell MET in mouse models. Cib2/Cib3 double
    knockout disrupts vestibular MET and balance, whereas either single knockout preserves substantial
    vestibular function. Region-specific structural and dye-uptake abnormalities can still occur in single
    mutants. CIB3 can rescue MET when introduced into Cib2-null cochlear hair cells, while CIB1 cannot.
    Endogenous cochlear CIB3 expression is low rather than absolutely absent. Vestibular compensation
    is not evidence of retinal compensation or a proven human modifier effect.
  biological_scale: CELLULAR
  mechanism_confidence: ESTABLISHED
  cell_types:
  - preferred_term: vestibular hair cell
    term:
      id: CL:0000609
      label: vestibular hair cell
  evidence:
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      CIB2 is a Ca2+- and Mg2+-binding protein essential for mechanoelectrical transduction (MET) by cochlear
      hair cells, but not by vestibular hair cells that co-express CIB2 and CIB3. Here, we show that in
      cochlear hair cells, CIB3 can functionally substitute for CIB2.
    explanation: >-
      Cochlear rescue supports functional substitution by CIB3; vestibular redundancy is tested directly
      in double-mutant experiments.
  - reference: PMID:34089643
    reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: Both CIB2 and CIB3, but not CIB1, rescued MET defects in OHCs from Cib2
    explanation: >-
      The rescue experiment, with CIB1 as the negative control that makes the result specific to the closest
      paralogue rather than to CIB overexpression generally.
  - reference: PMID:39773557
    reference_title: Complexes of vertebrate TMC1/2 and CIB2/3 proteins form hair-cell mechanotransduction cation channels.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      these results support compulsory but functionally redundant roles for CIB2 and CIB3 in the vestibular
      hair cell MET complex.
    explanation: Single- and double-mutant comparisons provide direct support for vestibular redundancy.
  - reference: PMID:37001993
    reference_title: >-
      CIB2 and CIB3 Regulate Stereocilia Maintenance and Mechanoelectrical Transduction in Mouse Vestibular
      Hair Cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      CIB2 and CIB3 act redundantly to regulate MET in VHCs, as MET currents are completely abolished
      in the VHCs of Cib2/Cib3 double knock-out mice of either sex.
    explanation: Independent double-knockout study supports the same mechanism.
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      the very low endogenous expression of CIB3 in the auditory hair cells cannot compensate for the
      lack of CIB2 in DFNB48
    explanation: The cochlear restriction is associated with low endogenous CIB3, not proven absolute absence.
phenotypes:
- category: Auditory
  name: Sensorineural hearing impairment
  description: >-
    Bilateral sensorineural hearing loss is the defining feature of DFNB48. Severity varies between families,
    including families with the same CIB2 founder variant. Stable longitudinal hearing thresholds were
    documented in one Dutch adult; this case does not establish a uniform stable course for every genotype.
  frequency: OBLIGATE
  phenotype_term:
    preferred_term: Sensorineural hearing impairment
    term:
      id: HP:0000407
      label: Sensorineural hearing impairment
  evidence:
  - reference: PMID:23023331
    reference_title: >-
      Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and nonsyndromic
      deafness DFNB48.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      One mutation in CIB2 is a prevalent cause of deafness DFNB48 in Pakistan; other CIB2 mutations contribute
      to deafness elsewhere in the world.
    explanation: Establishes CIB2 as a cause of DFNB48 deafness both in the founder population and beyond it.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all
      frequencies in all affected individuals.
    explanation: >-
      Audiometric characterisation across a multi-ethnic ARNSHL cohort, giving laterality, symmetry, onset,
      severity and frequency involvement in one measured statement.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Affected individuals of Pakistani family W09-1575 (Figure 1a) were diagnosed with prelingual, bilateral,
      moderate-to-severe sensorineural HI
    explanation: The clinical spectrum includes moderate-to-severe loss.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      VRA and pure tone audiometry revealed bilateral, profound sensorineural HI with a stable character
      and a gently downsloping audiogram configuration
    explanation: Longitudinal audiometry in Dutch family W06-0987 supports stability for that individual.
- category: Auditory
  name: Profound sensorineural hearing impairment
  description: >-
    Profound hearing loss occurs in several CIB2 families, but severity is not fixed by genotype. One
    Pakistani family homozygous for p.Phe91Ser had moderate-to-severe hearing loss while another with
    the same variant had profound loss.
  phenotype_term:
    preferred_term: Profound sensorineural hearing impairment
    term:
      id: HP:0011476
      label: Profound sensorineural hearing impairment
  evidence:
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all
      frequencies in all affected individuals.
    explanation: Establishes severe-to-profound severity across all affected individuals in the cohort.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      deafness segregating with the c.272T>C variant in one Pakistani family is remarkably less severe
      than that in all other families with this mutation
    explanation: >-
      Documents variable expressivity directly: the same recurrent allele gives markedly different severity
      between families, so severity is not fixed by genotype.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: In another Pakistani family W09-1600 the HI was profound, prelingual, bilateral and sensorineural
    explanation: This family establishes profound severity directly; other families have less severe hearing loss.
- category: Auditory
  name: Prelingual sensorineural hearing impairment
  description: >-
    Hearing loss precedes speech acquisition in the reported families. Congenital onset is directly documented
    in siblings who failed neonatal screening.
  phenotype_term:
    preferred_term: Prelingual sensorineural hearing impairment
    term:
      id: HP:0000399
      label: Prelingual sensorineural hearing impairment
  evidence:
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all
      frequencies in all affected individuals.
    explanation: Establishes prelingual onset by audiometry in every affected individual in the cohort.
- category: Auditory
  name: Bilateral sensorineural hearing impairment
  description: Hearing loss is bilateral and symmetric across all frequencies.
  phenotype_term:
    preferred_term: Bilateral, symmetric sensorineural hearing loss across all frequencies
    term:
      id: HP:0008619
      label: Bilateral sensorineural hearing impairment
  evidence:
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Audiometry revealed a bilateral symmetric prelingual severe-to-profound hearing loss across all
      frequencies in all affected individuals.
    explanation: Establishes bilaterality, symmetry and pan-frequency involvement in the same audiometric statement.
- category: Auditory
  name: Congenital sensorineural hearing impairment
  description: >-
    Two Dutch siblings with compound heterozygous CIB2 p.Arg33Ter/p.Arg66Trp variants failed neonatal
    hearing screening and had no BERA responses.
  phenotype_term:
    preferred_term: Congenital sensorineural hearing impairment
    term:
      id: HP:0008527
      label: Congenital sensorineural hearing impairment
  evidence:
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Both individuals of Dutch family 07-1069 (Figure 1c) were diagnosed with congenital, profound sensorineural
      hearing loss as they both failed the neonatal hearing screening.
    explanation: The two siblings provide direct evidence of congenital onset.
prevalence:
- population: Pakistani consanguineous hearing-loss cohorts
  measure_type: UNKNOWN
  prevalence_class: UNKNOWN
  notes: >-
    No population prevalence figure for DFNB48 specifically is available. The locus was mapped and is
    most often reported in consanguineous Pakistani families, so the case series are ascertainment-driven
    rather than population-based, and no rate is asserted here.
  evidence:
  - reference: PMID:30303587
    reference_title: Global genetic insight contributed by consanguineous Pakistani families segregating hearing loss.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      The five most common HL genes in the Pakistani population are SLC26A4, MYO7A, GJB2, CIB2 and HGF,
      respectively.
    explanation: >-
      Places CIB2 among the five most common hearing-loss genes in this population. A rank within an ascertained
      clinical cohort, not a population rate, which is why no rate_per_100000 is asserted.
genetic:
- name: CIB2
  gene_term:
    preferred_term: CIB2
    term:
      id: hgnc:24579
      label: CIB2
  relationship_type: CAUSATIVE
  notes: >-
    CIB2-related hearing loss includes homozygous and compound heterozygous genotypes. Reported variant
    classes include missense, nonsense, frameshift, splice-site and exon-deletion alleles. Founder effects
    were reported for p.Phe91Ser and p.Cys99Trp in Pakistani families. Hearing severity can differ among
    families with the same p.Phe91Ser genotype; these studies do not identify a proven human modifier
    or provide a population penetrance estimate. Splice and truncation consequences below distinguish
    prediction from directly measured functional results.
  evidence:
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      We expand the mutational spectrum of CIB2 to include copy number variations (CNVs), splice-site
      variants and indels
    explanation: Documents the breadth of the CIB2 allelic spectrum beyond point variants.
  - reference: PMID:28663585
    reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: we generated a p.F91S missense mutation knockin mouse
    explanation: >-
      Identifies p.F91S as the allele chosen for modelling because it is a recurrent Pakistani founder allele.
  variants:
  - name: c.272T>C (p.Phe91Ser)
    description: >-
      Recurrent Pakistani founder allele, homozygous in 54 DFNB48 families in the founding study. Moderate-to-severe
      and profound hearing loss have both been reported in families carrying this allele. The corresponding
      mouse knock-in loses cochlear MET despite preserved localization of mutant CIB2.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:23023331
      reference_title: >-
        Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and
        nonsyndromic deafness DFNB48.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: >-
        in affected subjects in 54 DFNB48 Pakistani families, we found a homozygous mutation (c.272T>C;
        p.Phe91Ser) of CIB2
      explanation: Reports the ascertainment count for the founding series, not population prevalence.
    - reference: PMID:26173970
      reference_title: >-
        Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
        buffering and localization in hair cells.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: >-
        deafness segregating with the c.272T>C variant in one Pakistani family is remarkably less severe
        than that in all other families with this mutation
      explanation: Variable expressivity limits severity prediction from this genotype alone.
  - name: c.297C>G (p.Cys99Trp)
    description: >-
      Missense variant segregating with deafness in two Pakistani families; linked haplotypes supported
      a founder effect.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:23023331
      reference_title: >-
        Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and
        nonsyndromic deafness DFNB48.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: in two DFNB48 families (DEM4025, DEM4225) a c.297C>G (p.Cys99Trp) CIB2 mutation co-segregated with deafness
      explanation: Human segregation evidence.
    - reference: PMID:23023331
      reference_title: >-
        Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and
        nonsyndromic deafness DFNB48.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: the flanking haplotypes were consistent with a founder effect for both alleles
      explanation: Refers to the recurrent c.272T>C and c.297C>G alleles in the same paragraph.
  - name: c.368T>C (p.Ile123Thr)
    description: >-
      Missense allele segregating with nonsyndromic hearing loss in a Turkish family. The corresponding
      knock-in mouse has abolished early cochlear MET currents.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:23023331
      reference_title: >-
        Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and
        nonsyndromic deafness DFNB48.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: a transition mutation c.368T>C (p.Ile123Thr) of CIB2 co-segregated with ARNSHI in Turkish DFNB48 family 802
      explanation: Clinical segregation is distinct from subsequent knock-in experiments.
    - reference: PMID:34089643
      reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: MET currents were abolished in OHC from Cib2I123T/I123T mice
      explanation: Functional loss in the allele-specific mouse model.
  - name: c.196C>T (p.Arg66Trp)
    description: Reported in homozygous and compound heterozygous genotypes, including in trans with c.300_309del in Trio-B.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: >-
        Compound heterozygous variants in CIB2: c.196C>T; p.Arg66Trp and c.300_309del; p.Glu100fs*28 were
        identified in the proband of family Trio-B
      explanation: Directly documents the frameshift allele in trans.
  - name: c.198+1G>A
    description: >-
      Homozygous canonical splice-site variant in family 51550. Exon-3 donor loss was predicted computationally,
      rather than established by a patient RNA assay. The proband underwent bilateral cochlear implantation.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: An ultra-rare homozygous splice-site variant in CIB2, c.198+1G>A, was identified in the proband of 51550
      explanation: Clinical genotype finding.
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: COMPUTATIONAL
      snippet: Computation splice-site predictions predicted the loss of the wild-type donor site of exon 3 in transcript 1
      explanation: Splice consequence is predicted.
  - name: c.300_309del (p.Glu100fs*28)
    description: >-
      Frameshift allele found in trans with p.Arg66Trp in Trio-B. The predicted truncation affects the
      coding sequence of all four transcripts described in the study.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: >-
        The second allele, c.300_309del is a rare frameshift variant that predicts a null allele and affects
        the coding sequence of all four transcripts
      explanation: Reported variant and predicted consequence; protein absence was not directly measured.
  - name: CIB2 exon-2 deletion (p.Asp18Alafs*7)
    description: >-
      A homozygous 3113-bp deletion in Iranian family L-3156 removes coding exon 2 from transcripts 1
      and 4. Read-depth inspection, PCR and breakpoint analysis identified the deletion; a frameshift
      and premature stop were predicted for these transcripts.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: >-
        The size of the deletion was determined to be 3113 bp with the breakpoints at chr15:78413407 and
        Chr15:78416520
      explanation: Breakpoint coordinates refer to the study reference genome, not a universal coordinate assembly.
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: This CNV removes the coding exon 2 (c.52_86delGACTGCACCTTCTTCAATAAGAAGGACATCCTCAA) from transcripts 1 and 4
      explanation: Defines the affected exon and transcript scope.
  - name: c.344A>G (p.Tyr115Cys)
    description: Homozygous missense variant segregating with nonsyndromic hearing loss in Iranian family L-1644.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: This novel missense variant changes a conserved tyrosine residue to a cysteine, p.Tyr115Cys
      explanation: Variant identified and segregated in the clinical family.
  - name: c.330T>A (p.Tyr110Ter)
    description: >-
      Nonsense allele associated with nonsyndromic hearing loss. It affects the coding sequences of all
      four CIB2 transcripts described in the study.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: >-
        A homozygous nonsense variant in CIB2, c.330T>A, p.Tyr110Terwas identified in the proband of family
        661 and was found to segregate with the hearing loss in the family
      explanation: Retains the source typography at the join between the protein variant and the verb.
  - name: c.34C>T (p.Gln12Ter)
    description: >-
      Homozygous nonsense allele reported in Iranian family L-700 with nonsyndromic hearing loss. This
      early stop affects a subset of CIB2 isoforms; it is not automatically an experimentally confirmed
      absence of every isoform.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/
      reference_title: CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival - PMC
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: This variant resulted in a premature stop codon at position 12 of the protein (p.Gln12*)
      explanation: Family L-700 variant identified through molecular testing and segregation.
  - name: c.97C>T (p.Arg33Ter)
    description: >-
      Nonsense allele found in trans with p.Arg66Trp in two Dutch siblings with congenital profound hearing
      loss. It affects some CIB2 isoforms; nonsense-mediated decay was predicted rather than directly
      measured.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:26173970
      reference_title: >-
        Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
        buffering and localization in hair cells.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: variants in the two affected children are present in the compound heterozygous state (c.[97C>T][196C>T]).
      explanation: Parental testing and Sanger confirmation support the compound heterozygous genotype.
  - name: c.223G>A (p.Val75Met)
    description: Homozygous missense allele identified in the proband of Trio-C with nonsyndromic hearing loss.
    gene:
      preferred_term: CIB2
      term:
        id: hgnc:24579
        label: CIB2
    evidence:
    - reference: PMID:29112224
      reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
      supports: SUPPORT
      evidence_source: HUMAN_CLINICAL
      snippet: 'a homozygous previously reported pathogenic alteration in CIB2: c.223G>A; p.Val75Met was identified'
      explanation: Reported genotype in Trio-C.
treatments:
- name: Cochlear Implantation
  description: >-
    Cochlear implantation provides auditory habilitation for eligible people with severe-to-profound DFNB48
    hearing loss. Two Dutch siblings received implants with good reported results, and a child homozygous
    for c.198+1G>A underwent successful bilateral implantation at 13 months. These are individual clinical
    reports, not a genotype-specific outcome rate.
  therapeutic_modality: DEVICE
  treatment_term:
    preferred_term: cochlear device implantation
    term:
      id: NCIT:C15329
      label: Surgical Procedure
    qualifiers:
    - predicate:
        preferred_term: medical device
        term:
          id: NCIT:C16830
          label: Medical Device
      value:
        preferred_term: cochlear implant
        term:
          id: NCIT:C157820
          label: Cochlear Implant
  target_mechanisms:
  - target: Impaired Cochlear Mechanoelectrical Transduction
    description: >-
      Substitutes electrical stimulation of the cochlear nerve for impaired hair-cell mechanotransduction,
      without restoring the transduction step itself.
  evidence:
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: Both hearing-impaired members of family 07-1069 received a cochlear implant with good results.
    explanation: Direct CIB2-specific outcomes in two siblings.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: The proband of family 51550 underwent bilateral cochlear implantation at 13 months
    explanation: Direct clinical timing in the splice-site family.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: A patient carrying this variant underwent successful bilateral cochlear implant implantation
    explanation: The discussion reports a successful outcome for the c.198+1G>A proband.
- name: Hearing Aids and Auditory Rehabilitation
  description: >-
    Hearing aids can support useful residual hearing, with fitting based on individual audiometry. Communication
    support, including sign language when desired, should be individualized. These are general genetic
    hearing-loss approaches; CIB2-specific hearing-aid outcomes were not established in the cited guidance.
  therapeutic_modality: DEVICE
  treatment_term:
    preferred_term: auditory rehabilitation with amplification
    term:
      id: NCIT:C15315
      label: Rehabilitation
    qualifiers:
    - predicate:
        preferred_term: medical device
        term:
          id: NCIT:C16830
          label: Medical Device
      value:
        preferred_term: hearing aid
        term:
          id: NCIT:C183182
          label: Hearing Aid
  notes: >-
    General care guidance; the treatment term describes rehabilitation and the qualifier identifies the
    hearing-aid device.
  evidence:
  - reference: url:https://www.ncbi.nlm.nih.gov/books/NBK1434/
    reference_title: Genetic Hearing Loss Overview - GeneReviews® - NCBI Bookshelf
    supports: SUPPORT
    evidence_source: OTHER
    snippet: >-
      customized by an audiologist to the degree and frequency of hearing loss, can be used in individuals
      with mild-to-severe hearing loss.
    explanation: General hearing-loss guidance applicable to residual hearing, including the less severe DFNB48 spectrum.
    directness: INDIRECT
  - reference: url:https://www.ncbi.nlm.nih.gov/books/NBK1434/
    reference_title: Genetic Hearing Loss Overview - GeneReviews® - NCBI Bookshelf
    supports: SUPPORT
    evidence_source: OTHER
    snippet: >-
      Habilitation for hearing loss includes improved access to sound through hearing aids or cochlear
      implants and, when desired, exposure to and teaching of American Sign Language.
    explanation: General communication and habilitation options, rather than a gene-specific efficacy study.
    directness: INDIRECT
- name: Auditory-Verbal Therapy
  description: >-
    Speech-language and auditory habilitation can support communication after implantation, individualized
    to the person and family. A general pediatric implant cohort associated appointment attendance with
    language outcomes; that observational association does not establish a CIB2-specific treatment effect
    or separate therapy exposure from family factors.
  therapeutic_modality: BEHAVIORAL
  treatment_term:
    preferred_term: speech therapy
    term:
      id: NCIT:C159273
      label: Speech Language Therapy
  target_mechanisms:
  - target: Sensorineural hearing impairment
    description: >-
      Addresses the language consequence of the sensory deficit rather than the cochlear lesion, by training
      use of the restored auditory input.
  evidence:
  - reference: PMID:42330611
    reference_title: >-
      Language outcomes following pediatric cochlear implantation: Associations with clinical, socioeconomic,
      and rehabilitation factors.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Higher appointment attendance was consistently associated with more favorable language outcomes
      following pediatric cochlear implantation.
    explanation: General pediatric implant cohort; the association is observational and not specific to CIB2.
    directness: INDIRECT
- name: Genetic Counseling
  description: >-
    Counseling follows confirmation of the molecular diagnosis and parental segregation. If both parents
    carry a pathogenic CIB2 allele, each pregnancy has a 25% chance of biallelic hearing loss, a 50% chance
    of carrier status and a 25% chance of inheriting neither familial allele. The disputed historical
    Usher assignment should not be presented as an established prediction of blindness for DFNB48.
  therapeutic_modality: OTHER
  treatment_term:
    preferred_term: Genetic Counseling
    term:
      id: NCIT:C15240
      label: Genetic Counseling
  evidence:
  - reference: url:https://www.ncbi.nlm.nih.gov/books/NBK1434/
    reference_title: Genetic Hearing Loss Overview - GeneReviews® - NCBI Bookshelf
    supports: SUPPORT
    evidence_source: OTHER
    snippet: has at conception a 25% chance of having hearing loss, a 50% chance of having no hearing loss
    explanation: General recessive hearing-loss counseling, conditional on both parents being confirmed carriers.
    directness: INDIRECT
- name: Experimental AAV-CIB2 Gene Augmentation
  description: >-
    Preclinical gene augmentation with AAV2.Anc80L65 carrying mouse Cib2 partially restored cochlear architecture
    and hearing in Cib2-null mice treated at P0-P4. P6 treatment did not improve hearing with this construct.
    In P0-P1-treated null mice, benefit persisted to 24 weeks and was strongest at lower frequencies;
    high-frequency recovery was limited. P0-treated F91S knock-in mice retained partial low-frequency
    benefit to P60, the last tested time. These mouse studies do not establish human efficacy, safety
    or a prenatal treatment window.
  therapeutic_modality: GENE_THERAPY
  treatment_term:
    preferred_term: Gene Therapy
    term:
      id: NCIT:C15238
      label: Gene Therapy
  target_mechanisms:
  - target: CIB2 Loss of Function
    description: Supplies functional CIB2 in cochlear hair cells.
  - target: Failure to Restrict Transducing Stereocilia Growth
    description: Partially restores bundle architecture in treated mouse cochleae.
  evidence:
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      We observed sustained, but partial, recovery of hearing function and restoration of stereocilia
      architecture in the apical to middle cochlear turns in mice having received AAV-Cib2 between postnatal
      day 0 (P0) and P4.
    explanation: >-
      Reports the rescue with its two important limits stated by the authors themselves: the recovery
      is partial and restricted to apical-to-middle turns, and it depends on treating within a narrow
      postnatal window.
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      no improvement in ABR thresholds (Figure 3B) or stereocilia bundle morphology was observed in Cib2ko/ko
      mice injected with Anc80.CIB2.GFP.WPRE at P6
    explanation: No rescue at the tested later age with this construct; not a universal point of irreversibility.
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: which persisted out to the latest time point tested, 24 weeks after injection
    explanation: Duration of partial rescue in the null model.
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      partial but significant improvements in the ABR thresholds at lower frequencies as early as P16,
      which persisted until P60, the last time point tested
    explanation: Allele-specific rescue in F91S knock-in mice.
- name: Experimental AAV-CIB3 Compensation
  description: >-
    AAV2.Anc80L65 delivery of human CIB3 at P0-P1 partially restored hearing in Cib2-null mice and improved
    hair-cell survival at P45. This is paralogue compensation rather than replacement of the mutated CIB2
    gene. Increasing endogenous CIB3 with transcriptional activation or small molecules remains a proposed
    strategy without demonstrated clinical efficacy.
  therapeutic_modality: GENE_THERAPY
  treatment_term:
    preferred_term: Gene Therapy
    term:
      id: NCIT:C15238
      label: Gene Therapy
  target_mechanisms:
  - target: Impaired Cochlear Mechanoelectrical Transduction
    description: Provides a paralogue able to substitute for CIB2 in the mouse cochlea.
  evidence:
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      overexpression of CIB3 via Anc80.CIB3.GFP.WPRE injection at P0–P1 restored persistent hearing function
      in Cib2ko/ko mice
    explanation: Human CIB3 cDNA was delivered to mice; this is not a human treatment result.
  - reference: PMID:42427029
    reference_title: >-
      Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model
      of recessive deafness DFNB48.
    supports: SUPPORT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      administration of Anc80.CIB3.GFP.WPRE significantly improved survival of both IHCs and OHCs in Cib2ko/ko
      mice at P45
    explanation: Hair-cell survival outcome was measured against GFP-vector controls.
animal_models:
- name: Cib2 knockout mouse
  species: Mouse
  genotype: Cib2 null (tm1a gene-trap or tm1b exon-4 deletion; Cib2KO/KO)
  publication: PMID:28663585
  description: >-
    Constitutive Cib2 null. Deaf, with mechanotransduction absent in auditory hair cells while tip links
    remain present, and with overgrowth of the shorter transducing stereocilia rows. Vestibular function
    is spared, matching the human non-syndromic phenotype.
  modeled_mechanisms:
  - target: Impaired Cochlear Mechanoelectrical Transduction
    relationship: RECAPITULATES
    fidelity: HIGH
    model_scale: CELLULAR
    description: >-
      Reproduces the experimentally demonstrated cochlear MET defect, including preserved tip links; equivalent
      human hair-cell electrophysiology was not reported.
    limitations: >-
      A constitutive null, whereas most reported human alleles are missense. Mouse cochlear TMC2 is replaced
      by TMC1 within the first postnatal days, so the developmental window differs from human.
    readouts:
    - name: Mechanotransduction current in auditory hair cells
      target: Impaired Cochlear Mechanoelectrical Transduction
      direction: ABOLISHED
      interpretation: Direct electrophysiological measure of the node in this model.
      evidence:
      - reference: PMID:34089643
        reference_title: CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
        supports: SUPPORT
        evidence_source: MODEL_ORGANISM
        snippet: MET currents were abolished in Cib2-deficient OHCs
        explanation: Patch-clamp measurement of the abolished current in outer hair cells.
    evidence:
    - reference: PMID:28663585
      reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: >-
        exhibit no mechanotransduction in auditory hair cells, despite the presence of tip links that
        gate the mechanotransducer channels
      explanation: >-
        The result that makes this model informative for the node: transduction fails with the force-delivery
        apparatus intact.
  - target: Failure to Restrict Transducing Stereocilia Growth
    relationship: RECAPITULATES
    fidelity: HIGH
    model_scale: CELLULAR
    description: Reproduces the stereocilia overgrowth arm.
    limitations: >-
      Bundle architecture was measured in mouse cochlea; these studies do not establish equivalent human
      temporal-bone histology.
    readouts:
    - name: Shorter-row stereocilia length
      target: Failure to Restrict Transducing Stereocilia Growth
      direction: INCREASED
      interpretation: Overgrowth of the transducing rows is the structural readout of this node.
      evidence:
      - reference: PMID:28663585
        reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
        supports: SUPPORT
        evidence_source: MODEL_ORGANISM
        snippet: mechanotransducing shorter row stereocilia overgrow in hair cell bundles of both Cib2 mutants
        explanation: Direct measurement of the overgrowth in both mutant lines.
- name: Cib2 p.F91S knock-in mouse
  species: Mouse
  genotype: Cib2 p.Phe91Ser knock-in (Cib2F91S/F91S)
  publication: PMID:28663585
  description: >-
    Carries the recurrent Pakistani founder allele p.Phe91Ser rather than a null, so it tests whether the
    disease missense variant, and not merely absence of the protein, causes the phenotype. It does: these
    mice are deaf with the same transduction and bundle defects.
  modeled_mechanisms:
  - target: CIB2 Loss of Function
    relationship: RECAPITULATES
    fidelity: HIGH
    model_scale: MOLECULAR
    description: >-
      Models a recurrent human missense allele, allowing comparison with complete loss of CIB2.
    limitations: >-
      Models one recurrent founder allele. Other disease-associated missense alleles have distinct effects
      on TMC binding, localization and residual channel activity.
    evidence:
    - reference: PMID:28663585
      reference_title: CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: we generated a p.F91S missense mutation knockin mouse
      explanation: Establishes that the model carries the prevalent human deafness allele.
- name: Cib2 CRISPR exon-4 knockout mouse
  species: Mouse
  genotype: Cib2 exon-4 deletions introducing a premature stop
  publication: PMID:29255404
  description: >-
    Independent CRISPR knockout mice have absent cochlear MET before marked bundle deterioration. The
    endocochlear potential remains normal. Voltage-gated outer hair-cell currents are modestly reduced
    at P7 but not at P1 or P4; their contribution to deafness is unresolved. Reverse-polarity currents
    remain detectable, distinguishing conventional MET loss from loss of every mechanically evoked current.
  modeled_mechanisms:
  - target: Impaired Cochlear Mechanoelectrical Transduction
    relationship: RECAPITULATES
    fidelity: HIGH
    model_scale: CELLULAR
    description: Independent allele corroborates absent conventional MET in early auditory hair cells.
    limitations: Mouse electrophysiology does not measure residual current in human DFNB48.
    evidence:
    - reference: PMID:29255404
      reference_title: Loss of CIB2 Causes Profound Hearing Loss and Abolishes Mechanoelectrical Transduction in Mice.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: MET currents are also absent in P7 Cib2 knockout IHCs
      explanation: The same study reports absent outer hair-cell MET at P1, P4 and P7.
    - reference: PMID:29255404
      reference_title: Loss of CIB2 Causes Profound Hearing Loss and Abolishes Mechanoelectrical Transduction in Mice.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: Cib2 knockout mice maintain a normal potential in the scala media
      explanation: >-
        Preserved endocochlear potential argues against a primary loss of the cochlear electrical driving
        force in this model.
    - reference: PMID:29255404
      reference_title: Loss of CIB2 Causes Profound Hearing Loss and Abolishes Mechanoelectrical Transduction in Mice.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: reverse-polarity currents could be recorded in P4 Cib2 knockout OHCs
      explanation: The effect is selective for conventional hair-cell MET.
    - reference: PMID:29255404
      reference_title: Loss of CIB2 Causes Profound Hearing Loss and Abolishes Mechanoelectrical Transduction in Mice.
      supports: SUPPORT
      evidence_source: MODEL_ORGANISM
      snippet: The reduction of voltage-gated currents was not observed in P1 and P4 Cib2 knockout OHCs
      explanation: The modest reduction at P7 is developmental-stage dependent, unlike the early MET loss.
diagnosis:
- name: Genetic testing in bilateral prelingual sensorineural hearing loss
  description: >-
    Molecular testing identifies biallelic disease-causing CIB2 variants in the context of the auditory
    phenotype and segregation. Hearing-loss panels or genomic testing should include assessment for exon-level
    copy-number changes: one CIB2 family was resolved only after recognizing absent exon-2 sequence coverage
    and confirming a deletion by PCR. A variant of uncertain significance alone does not establish DFNB48.
  evidence:
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      Assessing the coverage for each gene in the region using IGV revealed absence of sequence reads
      mapping to exon 2 of CIB2
    explanation: Exon-level read-depth review identified a deletion missed by the initial small-variant candidate list.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: Long-range PCR found the deletion to segregate with hearing loss in the extended family
    explanation: Orthogonal confirmation and segregation supported the molecular diagnosis.
  - reference: url:https://www.ncbi.nlm.nih.gov/books/NBK1434/
    reference_title: Genetic Hearing Loss Overview - GeneReviews® - NCBI Bookshelf
    supports: SUPPORT
    evidence_source: OTHER
    snippet: can often identify the cause of genetic hearing loss while limiting identification of
    explanation: >-
      The quoted clause describes a multigene hearing-loss panel. The source separately cautions that
      variants of uncertain significance cannot establish or exclude a diagnosis.
- name: Audiological characterization and pre-implant imaging
  description: >-
    Audiometry and auditory brainstem responses characterize bilateral sensorineural loss. Neonatal screening
    detected congenital loss in two CIB2 siblings. Temporal-bone CT was normal in reported Dutch cases
    and in the child from family 51550; normal imaging supports implant assessment but does not distinguish
    DFNB48 from other genetic hearing losses.
  evidence:
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: During BERA no responses were found for both individuals.
    explanation: Auditory brainstem testing in the two siblings who failed neonatal screening.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: his preoperative temporal bone computed tomography showed normal cochlear anatomy.
    explanation: Clinical imaging in the implanted child from family 51550.
discussions:
- discussion_id: cib2_ush1j_reassignment
  kind: CONTROVERSY
  prompt: Does CIB2 cause Usher syndrome type 1J, or only non-syndromic deafness DFNB48?
  rationale: >-
    The founding report assigned p.Glu64Asp in one Pakistani family to USH1J. Later CIB2 cohorts, including
    truncating and exon-deletion genotypes, had nonsyndromic hearing loss; normal funduscopy in adults
    strengthens that counterevidence, while young children cannot exclude every later-onset manifestation.
    Minor vestibular findings in the Dutch series included slight hyperreflexia in one adult and unilateral
    weakness measured after cochlear implantation in one child; these do not establish the congenital
    vestibular areflexia of Usher type 1. Mouse CIB3 redundancy explains preserved vestibular function
    but does not establish retinal redundancy. A later retinal study reported RPE defects and reduced
    retinal responses in Cib2-deficient mice, so absence of mouse retinal involvement is not uniform across
    studies. Those experimental findings do not establish retinitis pigmentosa as a human DFNB48 phenotype.
  attaches_to:
  - disease#Autosomal Recessive Nonsyndromic Hearing Loss 48
  - pathophysiology#CIB3 Paralogue Redundancy in Vestibular Hair Cells
  evidence:
  - reference: PMID:23023331
    reference_title: >-
      Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and nonsyndromic
      deafness DFNB48.
    supports: SUPPORT
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      we report that mutations in CIB2, which encodes a calcium- and integrin-binding protein, are associated
      with nonsyndromic deafness (DFNB48) and Usher syndrome type 1J (USH1J)
    explanation: The original dual assignment as the founding paper stated it, which is the claim the later cohort disputes.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: REFUTE
    evidence_source: HUMAN_CLINICAL
    snippet: This report is the first to show that biallelic LOF variants in CIB2 cause ARNSHL and not USH.
    explanation: >-
      Refutes the USH1J assignment for loss-of-function genotypes, which is the strongest test since null
      alleles are the ones classically expected to give the syndromic phenotype.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: REFUTE
    evidence_source: HUMAN_CLINICAL
    snippet: Here, we provide evidence disqualifying CIB2 as an USH-causing gene.
    explanation: The authors' explicit statement of the reassignment they are arguing for.
  - reference: PMID:29084757
    reference_title: CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival.
    supports: REFUTE
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      We report here two new nonsense mutations (pGln12* and pTyr110*) in CIB2 patients displaying nonsyndromic
      profound hearing loss, with no evidence of vestibular or retinal dysfunction.
    explanation: Additional human truncating-variant families challenge a general syndromic assignment.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: NO_EVIDENCE
    evidence_source: HUMAN_CLINICAL
    snippet: Vestibular examination showed a slight hyperreflexia.
    explanation: Minor vestibular finding in one Dutch adult, not evidence of congenital areflexia.
  - reference: PMID:26173970
    reference_title: >-
      Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium
      buffering and localization in hair cells.
    supports: NO_EVIDENCE
    evidence_source: HUMAN_CLINICAL
    snippet: This was examined after cochlear implantation at the left ear.
    explanation: >-
      The unilateral weakness reported immediately before this sentence was assessed after implantation,
      limiting causal attribution.
  - reference: PMID:34162842
    reference_title: CIB2 regulates mTORC1 signaling and is essential for autophagy and visual function.
    supports: SUPPORT
    directness: INDIRECT
    evidence_source: MODEL_ORGANISM
    snippet: >-
      These results suggest that both haploinsufficiency and complete loss of CIB2 leads to rod PR dysfunction
      in mice.
    explanation: >-
      This later mouse RPE/retinal study differs from earlier negative retinal assessments. It does not
      establish retinitis pigmentosa in human DFNB48.
  - reference: PMID:29112224
    reference_title: Variants in CIB2 cause DFNB48 and not USH1J.
    supports: REFUTE
    evidence_source: HUMAN_CLINICAL
    snippet: >-
      These persons all have normal funduscopy, suggesting that pathogenic variants in CIB2, irrespective
      of variant effect be it missense or truncating, do not cause USH.
    explanation: >-
      The preceding source paragraph identifies adults aged 20, 49 and 28. This is stronger counterevidence
      than absence of retinal signs in young children, but not proof that every allele excludes retinal
      disease.
📚

References & Deep Research

References

17
PMID:29112224
Variants in CIB2 cause DFNB48 and not USH1J.
No top-level findings curated for this source.
PMID:23023331
Alterations of the CIB2 calcium- and integrin-binding protein cause Usher syndrome type 1J and nonsyndromic deafness DFNB48.
No top-level findings curated for this source.
PMID:28663585
CIB2 interacts with TMC1 and TMC2 and is essential for mechanotransduction in auditory hair cells.
No top-level findings curated for this source.
PMID:39773557
Complexes of vertebrate TMC1/2 and CIB2/3 proteins form hair-cell mechanotransduction cation channels.
No top-level findings curated for this source.
PMID:40000792
Structural insights into calcium-dependent CIB2-TMC1 interaction in hair cell mechanotransduction.
No top-level findings curated for this source.
PMID:34089643
CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells.
No top-level findings curated for this source.
PMID:40083274
CIB2 function is distinct from that of whirlin in the organization of sterocilia architecture.
No top-level findings curated for this source.
PMID:26173970
Novel and recurrent CIB2 variants, associated with nonsyndromic deafness, do not affect calcium buffering and localization in hair cells.
No top-level findings curated for this source.
url:https://pmc.ncbi.nlm.nih.gov/articles/PMC5709726/
CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival - PMC
No top-level findings curated for this source.
PMID:37001993
CIB2 and CIB3 Regulate Stereocilia Maintenance and Mechanoelectrical Transduction in Mouse Vestibular Hair Cells.
No top-level findings curated for this source.
PMID:42427029
Rescue of stereocilia architecture and hearing function by AAV-CIB2 and AAV-CIB3 in a mouse model of recessive deafness DFNB48.
No top-level findings curated for this source.
PMID:30303587
Global genetic insight contributed by consanguineous Pakistani families segregating hearing loss.
No top-level findings curated for this source.
url:https://www.ncbi.nlm.nih.gov/books/NBK1434/
Genetic Hearing Loss Overview - GeneReviews® - NCBI Bookshelf
No top-level findings curated for this source.
PMID:42330611
Language outcomes following pediatric cochlear implantation: Associations with clinical, socioeconomic, and rehabilitation factors.
No top-level findings curated for this source.
PMID:29255404
Loss of CIB2 Causes Profound Hearing Loss and Abolishes Mechanoelectrical Transduction in Mice.
No top-level findings curated for this source.
PMID:29084757
CIB2, defective in isolated deafness, is key for auditory hair cell mechanotransduction and survival.
No top-level findings curated for this source.
PMID:34162842
CIB2 regulates mTORC1 signaling and is essential for autophagy and visual function.
No top-level findings curated for this source.

Deep Research

1

Deep research results are used as seeds for research; they do not undergo the same validation as the main records and may contain errors. How we use deep research.

Evaluations and curation notes (1)

Create: Autosomal Recessive Nonsyndromic Hearing Loss 48 (DFNB48, CIB2) · 2026-09-04T16:48:16Z · View source

De-novo curation of DFNB48 (MONDO:0012273, CIB2). Deep research: openscientist (research/Autosomal_Recessive_Nonsyndromic_Hearing_Loss_48-deep-research-openscientist.md), 1102s, 16/16 references resolved with 0 confabulations and 13/16 assessed on topic; term validation flagged needs_review only for benign label abbreviations (HP:0008619 called 'Bilateral SNHL'), none of which affect terms bound in this entry. GeneReviews baseline: no CIB2- or DFNB48-specific chapter exists; the Genetic Hearing Loss Overview (PMID:20301607) is cached and listed in references, but its cached record is book front matter with no quotable Clinical Characteristics, so no evidence item is attached to it. Pathophysiology is built as a causal chain from CIB2 loss of function through disrupted CIB2-TMC1/TMC2 association and abolished cochlear MET to hair-cell death, with a second parallel arm for failure to restrict transducing stereocilia growth. A CIB3 paralogue-redundancy node is included deliberately without a downstream edge: it explains the absence of vestibular involvement rather than causing a phenotype. The CIB2/USH1J reassignment is recorded as a CONTROVERSY discussion carrying both the original dual assignment and the later refutations, since the difference is clinically consequential. Validation: just validate passes (schema, terms, references) with 27/27 snippets verified; check-entity-refs, check-causal-targets, check-duplicate-keys and check-qualifier-terms all pass. An initial draft used publication titles as evidence snippets; all seven were replaced with quoted findings from the cached abstracts before commit. A later pass in the same session wired two audiological phenotypes (Profound and Congenital sensorineural hearing impairment) into the pathograph as downstream targets of Hair Cell Dysfunction and Death; a connectivity audit had found them present as phenotypes but with no incoming mechanism edge.

OpenScientist ▸
1. Disease Information
openscientist-autonomous 2026-09-04T16:40:05.216813

1. Disease Information

  • Overview: A rare, inherited form of nonsyndromic sensorineural hearing impairment presenting at/before birth, caused by dysfunction of the cochlear hair‑cell mechanotransduction apparatus. It is isolated (nonsyndromic) — hearing loss is the only clinical feature.
  • Key identifiers:
  • OMIM (phenotype): #609439 — "Deafness, autosomal recessive 48 (DFNB48)"
  • Gene: CIB2, OMIM *605564; HGNC:24579; NCBI Gene: 10518; Ensembl: ENSG00000136010; UniProt: O75838; locus 15q25.1
  • MONDO: maps to OMIM:609439 (autosomal recessive nonsyndromic hearing loss 48)
  • ICD‑11: AB52 (sensorineural hearing loss) / hereditary hearing impairment; ICD‑10: H90.3–H90.5 (no DFNB48‑specific code)
  • MeSH: "Hearing Loss, Sensorineural"; "Deafness"
  • Orphanet: within "Rare genetic deafness / autosomal recessive nonsyndromic sensorineural deafness type DFNB"
  • Synonyms: DFNB48; Deafness, autosomal recessive 48; CIB2‑related nonsyndromic hearing loss.
  • Information source: Aggregated disease‑level resources (OMIM/Orphanet) plus individual patient/consanguineous‑pedigree studies (predominantly Pakistani, plus Iranian, Turkish, Dutch families). Evidence type: human clinical + model organism + in vitro.

Primary citations: PMID 23023331 (Riazuddin 2012, discovery); PMID 29112224 (Booth 2018, NSHL vs USH).

2. Etiology

  • Primary cause — genetic: Biallelic pathogenic variants in CIB2 (necessary and sufficient). Loss‑of‑function (nonsense, frameshift, splice) and specific missense variants cause disease via loss of function; heterozygous carriers are unaffected (PMID 29112224, 23023331).
  • Genetic risk factors: The CIB2 genotype itself; consanguinity / autozygosity (94.4% of affected individuals in Pakistani cohorts are homozygous; PMID 30303587); founder ancestry carrying c.272T>C p.(Phe91Ser).
  • Environmental risk factors: None established. DFNB48 is not caused by toxins, noise, occupational exposure, radiation, diet, or lifestyle. General ototoxins (aminoglycosides) and noise are not specifically linked to CIB2 (contrast MT‑RNR1 m.1555A>G). Sex: no predilection (autosomal). Family history/consanguinity are the operative demographic risks.
  • Protective factors: No human protective alleles identified. Biologically, the paralog CIB3 provides intrinsic redundancy in the vestibule and retina (limiting the phenotype to hearing) but does not protect the cochlea (PMID 34089643).
  • Gene–environment interactions: None documented specifically for CIB2.
  • Epigenetic / chromosomal mechanisms: None known; no recurrent CNV/structural or methylation mechanism reported.

3. Phenotypes

Core phenotype (100% of affected): bilateral sensorineural hearing loss.

Phenotype HPO term Characteristics
Sensorineural hearing impairment HP:0000407 Clinical sign; the defining feature
Bilateral SNHL HP:0008619 Bilateral, symmetric
Congenital/prelingual SNHL HP:0008527 / HP:0008573 Onset at birth / before speech
Profound SNHL HP:0011476 Most common severity (esp. LOF genotypes)
Severe SNHL HP:0008625 Also reported; some milder cases
  • Onset: neonatal/congenital or prelingual.
  • Severity: typically severe‑to‑profound; variable — deafness with c.272T>C in one Pakistani family was "remarkably less severe" than in other families with the same allele, indicating variable expressivity/modifiers (PMID 26173970).
  • Progression: generally stable/non‑progressive; chronic, lifelong.
  • Frequency among affected: hearing loss ~100%; notably ABSENT are retinitis pigmentosa (HP:0000510) and vestibular dysfunction — their absence defines the nonsyndromic status vs USH1J.
  • Quality‑of‑life impact: primary burden is on spoken‑language acquisition, communication, education, and psychosocial development; largely mitigated by early amplification/cochlear implantation. No pain, no systemic morbidity.

Citations: PMID 29112224, 26173970, 29086887.

4. Genetic / Molecular Information

  • Causal gene: CIB2 — calcium‑ and integrin‑binding family member 2 (HGNC:24579; OMIM *605564; NCBI 10518; UniProt O75838). Encodes a small (~187 aa) EF‑hand protein with calcium‑binding domains.
  • Pathogenic variants (representative):
  • c.272T>C, p.(Phe91Ser) — recurrent founder missense, prevalent DFNB48 cause in Pakistan (PMID 23023331, 29086887).
  • c.196C>T p.(Arg66Trp), c.97C>T, c.556C>T and other missense (PMID 26173970).
  • Nonsense/LOF: e.g., p.(Gln12), p.(Tyr110) (PMID 29084757); frameshift and additional LOF alleles (PMID 29112224).
  • Variant classification: Pathogenic / likely pathogenic per ACMG/AMP (ClinVar). Biallelic LOF → ARNSHL (not USH) (PMID 29112224).
  • Variant types: missense, nonsense, frameshift, splice‑site (predominantly missense and LOF); no recurrent structural/CNV mechanism.
  • Allele frequency: individual pathogenic alleles are rare in gnomAD; founder alleles enriched in South‑Asian subpopulations.
  • Origin: germline (constitutional); not somatic.
  • Functional consequence: loss of function — disrupted CIB2–TMC1/TMC2 interaction and impaired stereocilia organization; missense alleles are proposed to alter integrin binding and channel modulation while preserving localization/calcium buffering in some cases (PMID 26173970).
  • Modifier genes: CIB3 (paralog, functional redundancy); WHRN (genetic interaction in mice; PMID 40083274). Other MET‑complex genes (TMC1/2, LHFPL5, TMIE, LOXHD1) are functional partners.
  • Epigenetics / chromosomal abnormalities: none established.

5. Environmental Information

Not applicable — DFNB48 is a purely genetic, monogenic disorder. No environmental toxin, radiation/pollution, occupational exposure, lifestyle factor (smoking/diet/alcohol/exercise), or infectious agent causes or triggers it. (Acquired congenital SNHL from e.g. congenital CMV/TORCH is a differential diagnosis, not a cause of DFNB48.)

6. Mechanism / Pathophysiology

Ordered causal chain (initiating lesion → clinical manifestation)

  1. Biallelic pathogenic CIB2 variant → loss of functional CIB2 protein (or a CIB2 that cannot bind its partners). [demonstrated]
  2. Loss of CIB2 → disrupted CIB2–TMC1/TMC2 interaction at the tips of shorter‑row stereocilia → the MET channel complex fails to operate, even though tip links remain intact. [demonstrated — PMID 28663585]
  3. In parallel branch: loss of CIB2 → loss of CIB2–WHRN‑dependent organization of the stereocilia staircase → abnormal stereocilia bundle morphology / overgrowth of shorter transducing‑row stereocilia. [demonstrated — PMID 28663585, 40083274]
  4. Non‑functional MET → failure to convert sound‑induced mechanical deflection into receptor (transduction) current → loss of hair‑cell depolarization/signaling. [demonstrated — abolished MET in mice]
  5. Loss of transduction + CIB2's role in survival → hair‑cell dysfunction and progressive hair‑cell degeneration in the organ of Corti. [demonstrated/inferred — PMID 29084757]
  6. Cochlear sensory failure → no afferent auditory signal to the cochlear nerve/CNS → congenital sensorineural hearing loss. [demonstrated]
  7. Branch (spared organs): In vestibule and retina, the paralog CIB3 (and CIB1) substitutes → balance and vision preserved → phenotype remains nonsyndromic. [demonstrated — PMID 34089643]

Detail by category

  • Molecular pathway / biochemical defect: hair‑cell mechanotransduction (an ion‑channel/receptor‑complex defect, not a classical signaling cascade). CIB2 is a Ca²⁺‑binding auxiliary subunit of the TMC1/TMC2 pore complex (with TMIE, LHFPL5, PCDH15). EF‑hand calcium binding modulates the complex.
  • Protein dysfunction: loss of function; disrupted protein–protein interactions (TMC1/2, WHRN). Missense variants may impair integrin/partner binding.
  • Cellular processes: impaired sensory transduction; hair‑cell degeneration/death; dysregulated stereocilia actin cytoskeleton/bundle morphogenesis.
  • Metabolic / immune / inflammatory: not implicated.
  • Tissue damage mechanism: sensory hair‑cell loss (not fibrosis/ischemia/autoimmune).
  • GO terms: sensory perception of sound (GO:0007605); inner ear receptor cell development (GO:0060113); regulation of stereocilium/microvillus length; calcium ion binding (GO:0005509). Cellular component: stereocilium (GO:0032420), stereocilium tip (GO:0032426), stereocilium bundle (GO:0032421).
  • Cell types (CL): cochlear inner hair cell (CL:0000589), cochlear outer hair cell (CL:0000601), auditory hair cell (CL:0000202).

Citations: PMID 28663585, 29255404, 40083274, 34089643, 29084757, 23023331.

7. Anatomical Structures Affected

  • Organ level (primary): cochlea (UBERON:0001844), specifically the organ of Corti / spiral organ (UBERON:0002227) within the inner ear (UBERON:0001846). Body system: nervous/sensory (auditory).
  • Secondary involvement: none directly; downstream central auditory pathway deprivation affects language cortex development if untreated.
  • Tissue/cell level: auditory sensory epithelium (neuroepithelium); affected cells = cochlear inner and outer hair cells (CL:0000589 / CL:0000601). Vestibular hair cells and retinal photoreceptors are spared in humans.
  • Subcellular level: the stereocilia and their tips (mechanotransduction apparatus); GO:0032420 stereocilium, GO:0032426 stereocilium tip; plasma membrane; EF‑hand Ca²⁺‑binding protein.
  • Localization / lateralization: bilateral, symmetric (HP:0008619).

Citations: PMID 23023331 (stereocilia localization); 28663585.

8. Temporal Development

  • Onset: congenital / prelingual; onset pattern is chronic (present from birth), not acute or episodic.
  • Progression: generally stable / non‑progressive; variable severity across genotypes/families. Disease duration is lifelong (chronic).
  • Course pattern: persistent; no relapsing‑remitting or fluctuating course; no spontaneous remission.
  • Critical period: early childhood auditory neuroplasticity window — early diagnosis and habilitation (EHDI 1‑3‑6 benchmark: screen ≤1 mo, diagnose ≤3 mo, intervene ≤6 mo) determine language outcomes; preclinical data show a developmental window for gene‑therapy rescue (PMID 42427029).

9. Inheritance and Population

  • Inheritance: autosomal recessive (biallelic). Recurrence risk 25% per pregnancy for carrier couples.
  • Penetrance: complete for biallelic pathogenic genotypes. Expressivity: variable (severity differs even for identical alleles; PMID 26173970).
  • Anticipation / mosaicism: not applicable / not reported.
  • Founder effects: c.272T>C p.(Phe91Ser) is a prevalent Pakistani founder allele (PMID 23023331, 29086887).
  • Consanguinity: major driver (homozygosity by descent; PMID 30303587).
  • Carrier frequency: rare in outbred populations; elevated in specific consanguineous kindreds; individual alleles rare in gnomAD.
  • Epidemiology: Overall congenital SNHL prevalence ≈ 1–3 per 1,000 newborns; DFNB48 is a small fraction of this globally but is one of the more common ARNSHL genes in Pakistan — 4th most common after SLC26A4, MYO7A, GJB2 (PMID 30303587), and among 13 genes accounting for >50% of profound HL in Pakistan (PMID 38534090). No precise DFNB48 prevalence/incidence figure is established (rare disease).
  • Demographics: enriched in South Asian (Pakistani/Iranian), Turkish, and some European (Dutch) kindreds; no sex bias; affected from birth (pediatric age distribution at diagnosis).

10. Diagnostics

  • Audiological (clinical) tests:
  • Screening: Universal Newborn Hearing Screening — otoacoustic emissions (OAE) + automated ABR (AABR/BERA) (PMID 42181374).
  • Confirmatory: diagnostic ABR, pure‑tone/behavioral audiometry, tympanometry (to exclude conductive loss). LOINC‑coded audiometry/OAE/ABR panels.
  • Imaging: temporal‑bone CT/MRI to exclude structural inner‑ear malformations (usually normal in DFNB48).
  • Laboratory biomarkers: none — no blood/urine/enzyme/metabolic biomarker; diagnosis is audiological + molecular.
  • Genetic testing (definitive):
  • NGS gene panels / whole‑exome sequencing targeting 150–250+ deafness genes (including CIB2): diagnostic yield ~21–48% for congenital SNHL (PMID 38224868 [48%], 29986705 [42%], 35580552 [21%]).
  • Single‑gene / targeted testing appropriate in founder populations (e.g., tetra‑primer ARMS for p.Phe91Ser; PMID 29086887).
  • WGS for panel/exome‑negative cases; CMA/karyotype/FISH/mtDNA/repeat testing are not indicated for isolated CIB2 deafness.
  • Variant interpretation per ACMG/AMP (ClinVar/ClinGen).
  • Clinical criteria / differential diagnosis: bilateral nonsyndromic SNHL with normal vision and balance. Rule out: other ARNSHL (GJB2/DFNB1, SLC26A4/Pendred, MYO15A, TMC1, OTOF/DFNB9); Usher syndrome (USH1J) — assess vision/vestibular function; acquired causes (congenital CMV/TORCH).
  • Screening (asymptomatic): newborn hearing screening; carrier screening and cascade testing of relatives.

11. Outcome / Prognosis

  • Survival/mortality: not life‑limiting; normal life expectancy; no disease‑specific mortality.
  • Morbidity/disability: communication and language disability; downstream educational and psychosocial impacts if unaddressed. ICF domains: hearing functions, communication, social participation.
  • Quality‑of‑life tools: generic (EQ‑5D, PROMIS) and hearing‑specific instruments; outcomes strongly modifiable by intervention.
  • Disease course/complications: stable auditory deficit; main "complication" is speech‑language delay without early habilitation.
  • Recovery potential: none spontaneously; substantial functional recovery of hearing/oral language with cochlear implantation, especially when performed early.
  • Prognostic factors: age at intervention (earlier = better), rehabilitation intensity/appointment adherence, neurodevelopmental comorbidities, and cochlear/cochlear‑nerve integrity on imaging (PMID 42330611, 41895171). No molecular prognostic biomarker beyond genotype–severity trends.

12. Treatment

  • Pharmacotherapy: None corrects the MET defect (no approved drug; no pharmacogenomic modifier). NCIT: n/a.
  • Rehabilitative / device (standard of care):
  • Hearing aids (residual hearing) — NCIT: Hearing Aid.
  • Cochlear implantation for severe‑to‑profound loss — NCIT: Cochlear Implant; paired with auditory‑verbal / speech‑language therapy (NCIT: Speech Therapy). Language outcomes depend on early implantation and rehabilitation (PMID 42330611, 41895171).
  • Advanced/experimental — gene therapy:
  • Preclinical (CIB2‑specific): single semicircular‑canal AAV‑Cib2 (and AAV‑Cib3) injection restored stereocilia architecture and hearing in Cib2‑mutant mice within a critical window (PMID 42427029). NCIT: Gene Therapy; AAV Vector.
  • Clinical precedent (analogous gene): AAV cochlear gene therapy for biallelic OTOF/DFNB9 — FDA‑approved Otarmeni (2026); ~75% of early‑trial children met the primary hearing endpoint at 24 weeks (PMID 42470357); ≥5 DFNB9 trials ongoing (PMID 41812306). Establishes feasibility; CIB2 gene therapy remains preclinical.
  • Surgical: cochlear implant surgery (transmastoid/round‑window).
  • Treatment strategy: etiology‑guided, early habilitation; emerging "restore when biology permits, bypass when it does not" hierarchy (PMID 42470357). Personalized medicine: genotype‑directed eligibility for future gene therapy.

13. Prevention

  • Primary prevention: no lifestyle/vaccine route (monogenic). Risk reduction is genetic: preconception genetic counseling, expanded carrier screening, and reproductive options — prenatal diagnosis and preimplantation genetic testing (PGT‑M) for known familial variants; counseling on consanguinity risk. NCIT: Genetic Counseling; Carrier Screening; Prenatal Diagnosis; Preimplantation Genetic Testing.
  • Secondary prevention: universal newborn hearing screening → early diagnosis → early habilitation (EHDI 1‑3‑6).
  • Tertiary prevention: cochlear implantation + intensive (re)habilitation to prevent language/developmental morbidity; educational support.
  • Cascade screening: test at‑risk relatives once a familial genotype is known.
  • Public health: deafness gene carrier‑screening programs (already impactful for GJB2 in some populations); consanguinity education in high‑risk communities.

14. Other Species / Natural Disease

  • Taxonomy / orthologs: CIB2 is evolutionarily conserved. Orthologs: mouse Cib2 (NCBI Gene 208768; NCBI Taxon 10090), zebrafish cib2 (Taxon 7955), Drosophila melanogaster ortholog (Taxon 7227) — all required for hair‑cell/mechanosensory function (PMID 23023331).
  • Natural disease / veterinary: No spontaneous naturally occurring CIB2 deafness is catalogued in OMIA as a recognized companion‑animal/wildlife disease; disease models are engineered. (Not applicable / none reported.)
  • Comparative pathology: mouse and zebrafish reproduce hair‑cell mechanotransduction failure; conservation of the MET‑complex mechanism across vertebrates and invertebrates supports deep evolutionary conservation of CIB2 function.
  • Transmission: not applicable (non‑infectious, non‑zoonotic).

15. Model Organisms

  • Mouse (Mus musculus, primary model):
  • Cib2‑knockout and human deafness knock‑in lines: deaf, no cochlear MET, stereocilia bundle defects/overgrowth (PMID 28663585, 29255404).
  • Genetic‑interaction model: Cib2;Whrn double mutants (PMID 40083274).
  • Recapitulation: faithfully models profound congenital deafness and MET loss. Limitation / species difference: mice show vestibular dysfunction (vestibular CIB3 compensation differs from human) and no retinal degeneration, so mice do not fully mirror the human "hearing‑only, balance‑normal" phenotype.
  • Resources: MGI, IMPC.
  • Zebrafish (Danio rerio): cib2 required for hair‑cell function/development (PMID 23023331); resource: ZFIN.
  • Drosophila melanogaster: CIB2 ortholog essential for hair‑cell/mechanosensory development (PMID 23023331); resource: FlyBase.
  • In vitro / cellular: heterologous expression (COS‑7) for calcium‑response and localization assays (PMID 26173970); AlphaFold2‑multimer structural modeling of CIB2–WHRN (PMID 40083274).
  • Applications: dissecting MET‑complex assembly, stereocilia morphogenesis, genotype–function relationships, and AAV gene‑therapy proof‑of‑concept (PMID 42427029).

Supported vs Refuted Hypotheses

Supported - CIB2 biallelic variants cause DFNB48 via loss of hair‑cell MET (PMID 28663585, 29255404). - Biallelic LOF causes nonsyndromic deafness, not Usher syndrome (PMID 29112224). - CIB2 has an independent WHRN‑dependent role in stereocilia architecture (PMID 40083274). - CIB3 redundancy explains sparing of vestibule/retina (PMID 34089643). - AAV gene therapy can rescue the cochlear phenotype in models (PMID 42427029); clinically validated for the analogous OTOF deafness (PMID 42470357).

Refuted / revised - The original proposal that CIB2 causes Usher syndrome type 1J is refuted for biallelic LOF genotypes (PMID 29112224); CIB2 has been "disqualified as an USH‑causing gene."

Limitations and Future Directions

  • Limitations: No large natural‑history registry or precise DFNB48 prevalence; genotype–phenotype (severity) correlations are incompletely explained (modifiers such as CIB3 dosage remain hypothetical); most mechanistic evidence is from mouse/zebrafish, which imperfectly mirror the human sensory‑organ‑specificity; no human‑specific molecular biomarker.
  • Future directions: (1) CIB2‑targeted AAV gene therapy toward first‑in‑human trials; (2) high‑resolution structures of the CIB2–TMC1 MET complex to guide variant interpretation and therapy; (3) systematic ACMG re‑classification of CIB2 VUS with functional assays; (4) modifier‑gene (CIB3/WHRN) studies to explain variable expressivity; (5) equitable carrier‑screening and counseling in high‑consanguinity populations.

Key References (PMID)

23023331 · 29112224 · 28663585 · 29255404 · 29084757 · 40083274 · 34089643 · 42427029 · 30303587 · 29086887 · 26173970 · 38534090 · 38224868 · 29986705 · 35580552 · 42181374 · 42470357 · 41812306 · 42330611 · 41895171

Artifacts

Reference Validation

Checked with linkml-reference-validator 0.2.1.

Outcome Count
References checked 16
Resolved 16
Unresolved (possible confabulation) 0
Unverifiable 0
References weighed for topical relevance 16
On topic 13
Off topic 0

All extracted references resolved successfully.

Term Validation

Checked with linkml-term-validator 0.4.5, through the ols: adapter.

Outcome Count
Terms checked 21
Resolved 19
Unresolved (possible confabulation) 0
Obsolete 0
Unverifiable 2
Terms whose name was checked 8
Terms named correctly 2
Terms named as a different term 1
Terms whose name is worth a second look 5

Terms the report names something else

These identifiers resolve, so nothing about them looks wrong, and the ontology calls them something unrelated to what the report calls them. That usually means the identifier is not the one the sentence needs:

  • HP:0008619 (2 mentions) - the report calls it "Bilateral SNHL", "bilateral, symmetric", "Localization / lateralization: bilateral, symmetric"; HP calls it Bilateral sensorineural hearing impairment

Terms whose name is worth a second look

The report's name for these is recognisably related to the term's own name without being one of them. A loose paraphrase reads the same way as a citation of the wrong sibling term - and so does a related synonym, which the ontology records precisely because it names something adjacent rather than the same thing - so these are listed rather than judged:

  • HP:0011476 (1 mention) - the report calls it "Profound SNHL"; HP calls it Profound sensorineural hearing impairment, and lists "Profound sensorineural hearing loss" among its other names
  • HP:0008625 (1 mention) - the report calls it "Severe SNHL"; HP calls it Severe sensorineural hearing impairment, and lists "Severe sensorineural deafness" among its other names
  • GO:0007605 (1 mention) - the report calls it "GO terms: sensory perception of sound"; GO calls it sensory perception of sound**
  • UBERON:0002227 (1 mention) - the report calls it "organ of Corti / spiral organ"; UBERON calls it spiral organ of cochlea, and lists "spiral organ of Corti" among its other names
  • UBERON:0001846 (1 mention) - the report calls it "inner ear"; UBERON calls it internal ear, and lists "inner ear" among its other names

Terms named inconsistently

The report gives these identifiers more than one name of its own:

  • HP:0008619 - called "Bilateral SNHL", "bilateral, symmetric", "Localization / lateralization: bilateral, symmetric"

Prefixes with no resolver

Terms carrying these prefixes were not checked either way, because no configured ontology covers them. An unrecognised prefix may name an ontology this run could not reach as easily as one that does not exist, so nothing here is evidence of fabrication: OMIM.